Folliculin (FLCN) - 1128 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.27264
gtaagcaacagtgtgggtgaggcccctttgcttgcgaccctggagaaaacctggagctgt  c.1538+60

         .         .         .         .         .         .  g.27324
ttccaaaagaggagctgggccgtggccactgagggaggagccgagagaagaggttggggg  c.1538+120

         .         .         .         .         .         .  g.27384
cggggttccaactccacgtccgccactgcaaagctcaggtggcctcgggaggcggtcatc  c.1538+180

         .         .         .         .         .         .  g.27444
atgtctgcctccggctcctgcatggggaggtgggggtggcgcctgccttggagagcgact  c.1538+240

         .         .         .         .         .         .  g.27504
gaggcttgggcaagggctccaagctcacaggagggttcataatggaagctctgtcatctg  c.1538+300

         .         .         .         .         .         .  g.27564
ctgtgcaattaacttcaaaacctaaaagcccagtaacccatgccccaccccgctttttat  c.1538+360

         .         .         .         .         .         .  g.27624
tttattttatttttattttttattttttttgagtcagagtttggctcttgttgcccaggc  c.1538+420

         .         .         .         .         .         .  g.27684
tggagtgcaatggcatgatcttggctcaccacaacctccgcctcccgggttcaagcgatt  c.1538+480

         .         .         .         .         .         .  g.27744
cttctgcctcagcctctggagtagctgggattacaggcacccaccaccatgcctggctaa  c.1538+540

         .         .      g.27768
tatttgtatttttagtagagacag  c.1538+564

--------------------- middle of intron ---------------------
                        g.27769         .         .           g.27792
                        c.1539-564  ggttttagcatgttggccaggctg  c.1539-541

.         .         .         .         .         .           g.27852
gtcttgaactcctgacttcgtgatccgcccaccttggcctcccaaagtgctgggattaca  c.1539-481

.         .         .         .         .         .           g.27912
ggcgtgagccactgcacctggccccccgggtttttttttttgtaagcaaatttactttat  c.1539-421

.         .         .         .         .         .           g.27972
ttcctcctgcctcgattcttggtaattttttgggtcaaatttattaatcaaacattgtcc  c.1539-361

.         .         .         .         .         .           g.28032
tgatttaaaatcatgcagtgaagcttaggagcaaccagtgtcttccacgagtttaaggaa  c.1539-301

.         .         .         .         .         .           g.28092
ggtttttctttcttcttggcgtcttgacaacagcttgagggagggtgtgggaagcgcaca  c.1539-241

.         .         .         .         .         .           g.28152
ggccccatacccatacccgacagagggccgagcccagccccgacagcttcccttccttgc  c.1539-181

.         .         .         .         .         .           g.28212
tgggacacagctcctttcagcagttcaggggccaagcctgctgccccaagggtgtggatt  c.1539-121

.         .         .         .         .         .           g.28272
ccagctctgcctgcacagctcctgctggtgccaaagccgtgtcacccctggttggccccg  c.1539-61

.         .         .         .         .         .           g.28332
tgaccagggctcgagggattgtgctgtggtgtctgagtgttttgttttggttttcttcag  c.1539-1


Powered by LOVDv.2.0-18 Build 18
©2004-2009 Leiden University Medical Center