Folliculin (FLCN) - coding DNA reference sequence

(used for mutation description)

(last modified June 18, 2009)


This file was created to facilitate the description of sequence variants in the FLCN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NM_144997.5


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5024
                                     gagtcacgcgcctgggtgtcggcg       c.-481

 .         .         .         .         .         .                g.5084
 gggctgcgggaccgcgagtgagtgtggtcgctcctggttctgccagctcccctgagagcc       c.-421

 .         .         .         .         .         .                g.5144
 tgaacccgggcttgagagcctcgccaccccgggtgacatccctgccgtgggcttgggggc       c.-361

 .         .         .         .         .         .                g.5204
 tctgggtgtgattccgccggtccgggtcccgcagcgaccacctacccagcgcagtcaggg       c.-301

 .         .         .         .         .         .                g.5264
 gcggggctgggacccagagcgggaccccggctgccgagtccaggtgtcccgcgggcctcg       c.-241

 .         .   | 02     .         .         .         .             g.9334
 atttggggagcag | aaaacgccaggtcttcaagggtgtctgccaccaccatgcctgaccca    c.-181

 .         .         .         .         .         .                g.9394
 tttggcagcagcctcgtgtgtggtggtctggtgtggacggtggaagcgtgattctgctga       c.-121

 .       | 03 .         .         .         .         .             g.10359
 gtgtcag | tgtgaccactcgtgctcagccgtatctcagcaggaggacaggtgccggagcag    c.-61

 .         .         .         .      | 04  .         .             g.14051
 ctcgtgcagctaagcagccaactgcagaaacgtcag | gcctgttgcagtctccaaggcacc    c.-1

          .         .         .         .         .         .       g.14111
 ATGAATGCCATCGTGGCTCTCTGCCACTTCTGCGAGCTCCACGGCCCCCGCACTCTCTTC       c.60
 M  N  A  I  V  A  L  C  H  F  C  E  L  H  G  P  R  T  L  F         p.20

          .         .         .         .         .         .       g.14171
 TGCACGGAGGTGCTGCACGCCCCACTTCCTCAAGGGGATGGGAATGAGGACAGTCCTGGC       c.120
 C  T  E  V  L  H  A  P  L  P  Q  G  D  G  N  E  D  S  P  G         p.40

          .         .         .         .         .         .       g.14231
 CAGGGTGAGCAGGCGGAAGAAGAGGAAGGTGGCATTCAGATGAACAGTCGGATGCGTGCG       c.180
 Q  G  E  Q  A  E  E  E  E  G  G  I  Q  M  N  S  R  M  R  A         p.60

          .         .         .         .         .         .       g.14291
 CACAGCCCCGCAGAGGGGGCCAGCGTCGAGTCCAGCAGCCCGGGGCCCAAAAAGTCGGAC       c.240
 H  S  P  A  E  G  A  S  V  E  S  S  S  P  G  P  K  K  S  D         p.80

           | 05        .         .         .         .         .    g.15917
 ATGTGCGAG | GGCTGCCGGTCACTTGCTGCAGGGCACCCGGGATATATCAGCCATGATAAA    c.300
 M  C  E   | G  C  R  S  L  A  A  G  H  P  G  Y  I  S  H  D  K      p.100

          .         .         .         .         .         .       g.15977
 GAGACCTCCATTAAATACGTCAGCCACCAGCACCCCAGCCACCCCCAGCTCTTCAGCATT       c.360
 E  T  S  I  K  Y  V  S  H  Q  H  P  S  H  P  Q  L  F  S  I         p.120

          .         .         .       | 06 .         .         .    g.18069
 GTCCGCCAGGCCTGTGTCCGGAGCCTGAGCTGTGAG | GTCTGCCCTGGCCGTGAAGGCCCC    c.420
 V  R  Q  A  C  V  R  S  L  S  C  E   | V  C  P  G  R  E  G  P      p.140

          .         .         .         .         .         .       g.18129
 ATCTTCTTCGGAGATGAGCAGCACGGCTTTGTGTTCAGCCACACCTTCTTCATCAAGGAC       c.480
 I  F  F  G  D  E  Q  H  G  F  V  F  S  H  T  F  F  I  K  D         p.160

          .         .         .         .         .         .       g.18189
 AGCCTGGCCAGGGGCTTCCAGCGCTGGTACAGCATCATCACCATCATGATGGACCGGATC       c.540
 S  L  A  R  G  F  Q  R  W  Y  S  I  I  T  I  M  M  D  R  I         p.180

          .         .         .         .         .         .       g.18249
 TACCTCATCAACTCCTGGCCCTTCCTGCTGGGGAAGGTCCGGGGAATCATCGATGAGCTC       c.600
 Y  L  I  N  S  W  P  F  L  L  G  K  V  R  G  I  I  D  E  L         p.200

          .         | 07         .         .         .         .    g.19569
 CAGGGCAAGGCGCTCAAG | GTGTTTGAGGCAGAGCAGTTTGGATGCCCACAGCGTGCTCAG    c.660
 Q  G  K  A  L  K   | V  F  E  A  E  Q  F  G  C  P  Q  R  A  Q      p.220

          .         .         .         .         .         .       g.19629
 AGGATGAACACAGCCTTCACGCCATTCCTACACCAGAGGAACGGCAACGCCGCCCGCTCG       c.720
 R  M  N  T  A  F  T  P  F  L  H  Q  R  N  G  N  A  A  R  S         p.240

          .         .         .         .         .          | 08    g.20561
 CTGACATCGCTGACAAGTGATGACAACCTGTGGGCGTGCCTGCACACCTCCTTTGCCTG | G    c.780
 L  T  S  L  T  S  D  D  N  L  W  A  C  L  H  T  S  F  A  W  |      p.260

          .         .         .         .         .         .       g.20621
 CTCCTGAAGGCGTGTGGCAGCCGGCTGACCGAGAAGCTCCTGGAAGGTGCTCCGACCGAG       c.840
 L  L  K  A  C  G  S  R  L  T  E  K  L  L  E  G  A  P  T  E         p.280

          .         .         .  | 09      .         .         .    g.23008
 GATACCTTGGTCCAGATGGAGAAGCTCGCTG | ATTTAGAAGAGGAATCAGAAAGCTGGGAC    c.900
 D  T  L  V  Q  M  E  K  L  A  D |   L  E  E  E  S  E  S  W  D      p.300

          .         .         .         .         .         .       g.23068
 AACTCTGAGGCTGAAGAGGAGGAGAAAGCCCCTGTGTTGCCAGAGAGTACAGAAGGGCGG       c.960
 N  S  E  A  E  E  E  E  K  A  P  V  L  P  E  S  T  E  G  R         p.320

          .         .         .         .         .         .       g.23128
 GAGCTGACCCAGGGCCCGGCAGAGTCCTCCTCTCTCTCAGGCTGTGGGAGCTGGCAGCCC       c.1020
 E  L  T  Q  G  P  A  E  S  S  S  L  S  G  C  G  S  W  Q  P         p.340

          .         .         .         .   | 10     .         .    g.25024
 CGGAAGCTGCCAGTCTTCAAGTCCCTCCGGCACATGAGGCAG | GTCCTGGGTGCCCCTTCT    c.1080
 R  K  L  P  V  F  K  S  L  R  H  M  R  Q   | V  L  G  A  P  S      p.360

          .         .         .         .         .         .       g.25084
 TTCCGCATGCTGGCCTGGCACGTTCTCATGGGGAACCAGGTGATCTGGAAAAGCAGAGAC       c.1140
 F  R  M  L  A  W  H  V  L  M  G  N  Q  V  I  W  K  S  R  D         p.380

          .         .         .       | 11 .         .         .    g.25709
 GTGGACCTCGTCCAGTCAGCTTTTGAAGTACTTCGG | ACCATGCTTCCCGTGGGCTGCGTC    c.1200
 V  D  L  V  Q  S  A  F  E  V  L  R   | T  M  L  P  V  G  C  V      p.400

          .         .         .         .         .         .       g.25769
 CGCATCATCCCATACAGCAGCCAGTACGAGGAGGCCTATCGGTGCAACTTCCTGGGGCTC       c.1260
 R  I  I  P  Y  S  S  Q  Y  E  E  A  Y  R  C  N  F  L  G  L         p.420

          .         .         .         . | 12       .         .    g.26892
 AGCCCGCACGTGCAGATCCCCCCCCACGTGCTCTCCTCAG | AGTTTGCTGTCATCGTGGAG    c.1320
 S  P  H  V  Q  I  P  P  H  V  L  S  S  E |   F  A  V  I  V  E      p.440

          .         .         .         .         .         .       g.26952
 GTCCACGCAGCCGCACGTTCCACCCTCCACCCTGTGGGGTGTGAGGATGACCAGTCTCTC       c.1380
 V  H  A  A  A  R  S  T  L  H  P  V  G  C  E  D  D  Q  S  L         p.460

          .         .         .         .         .   | 13     .    g.27106
 AGCAAGTACGAGTTTGTGGTGACCAGTGGGAGCCCTGTAGCTGCAGACCGAG | TGGGCCCC    c.1440
 S  K  Y  E  F  V  V  T  S  G  S  P  V  A  A  D  R  V |   G  P      p.480

          .         .         .         .         .         .       g.27166
 ACCATCCTGAATAAGATTGAAGCGGCTCTGACCAACCAGAACCTGTCTGTGGATGTGGTG       c.1500
 T  I  L  N  K  I  E  A  A  L  T  N  Q  N  L  S  V  D  V  V         p.500

          .         .         .         | 14         .         .    g.28354
 GACCAGTGCCTCGTCTGCCTCAAGGAGGAGTGGATGAA | CAAAGTGAAGGTGCTTTTTAAG    c.1560
 D  Q  C  L  V  C  L  K  E  E  W  M  N  |  K  V  K  V  L  F  K      p.520

          .         .         .         .         .         .       g.28414
 TTCACCAAGGTGGACAGTCGACCCAAAGAGGACACACAGAAGCTGCTGAGCATCCTGGGT       c.1620
 F  T  K  V  D  S  R  P  K  E  D  T  Q  K  L  L  S  I  L  G         p.540

          .         .         .         .         .         .       g.28474
 GCGTCCGAGGAGGACAATGTCAAGCTGCTGAAGTTCTGGATGACTGGCCTGAGCAAGACC       c.1680
 A  S  E  E  D  N  V  K  L  L  K  F  W  M  T  G  L  S  K  T         p.560

          .         .         .         .         .         .       g.28534
 TACAAGTCACACCTCATGTCCACGGTCCGCAGCCCCACAGCCTCGGAGTCTCGGAACTGA       c.1740
 Y  K  S  H  L  M  S  T  V  R  S  P  T  A  S  E  S  R  N  X         p.579

          .         .         .         .         .         .       g.28594
 cccgtcacacacacctgcctaaagacagggatggctgtccacaggatcctccagccccgt       c.*60

          .         .         .         .         .         .       g.28654
 gagagggactgtcccttgagtttctcaactgctggaaggagctgtgtcccagcaaggaag       c.*120

          .         .         .         .         .         .       g.28714
 ggaaaccatcagggctgggctcggccctgtcaggtttggggcctgtgtgcttcccagact       c.*180

          .         .         .         .         .         .       g.28774
 ctccctccagccgttggaatcgctgaagatggcaatgaaaggcggagggatgatgggctc       c.*240

          .         .         .         .         .         .       g.28834
 tctctgtgttcaaactccttggagagacgactaggaggacagcttgcctcccaggcccct       c.*300

          .         .         .         .         .         .       g.28894
 tgtggacttagactcaaaacccgcaggagaaacaggtccgactcagtatgcagtcgcaat       c.*360

          .         .         .         .         .         .       g.28954
 aacatgtctgctcccgaggttaacattcaagcgtttctactttgaaattcagcaagagtt       c.*420

          .         .         .         .         .         .       g.29014
 tctgggccttatgtttgagggtaccttttgctgcagttgtgaatattcagtacattgcca       c.*480

          .         .         .         .         .         .       g.29074
 gctcttggtcactgagtgattgagttagggctccgcaagagactttggggagtgaagtgg       c.*540

          .         .         .         .         .         .       g.29134
 atctcttcctcatcttttggtcctctgaaatgtgtgttctgaagccatggggctcgtctt       c.*600

          .         .         .         .         .         .       g.29194
 ctggggtgttcccctgcaggtgctggtgaaggtaacctggggcttaatgatggagtccct       c.*660

          .         .         .         .         .         .       g.29254
 gatcatttttgcacaagacaggttgctgaggggtcggcaagcatctgacttgcccaatcc       c.*720

          .         .         .         .         .         .       g.29314
 cctggatatggtgagccccgccatgcttttattctgtatcgcttttgtctttattgctgc       c.*780

          .         .         .         .         .         .       g.29374
 tttcaacatttacgtttggttacagttaactattttcggagtgtggtgattgaagacaat       c.*840

          .         .         .         .         .         .       g.29434
 ttcatcatcccactgtacttttttttttgagagggagtttcactcttgttgcccaggctg       c.*900

          .         .         .         .         .         .       g.29494
 gagtgcaatggcacgatcttggctcactgcaacctctgcctcctgggttcaagcaattct       c.*960

          .         .         .         .         .         .       g.29554
 cctgcctcagcctccagagtagctggaactacaggtgcccgccactatgcccagctaatt       c.*1020

          .         .         .         .         .         .       g.29614
 tttgtattttttagtagagacggggtttcaccgtgttggccgggctggtctcaaactcct       c.*1080

          .         .         .         .         .         .       g.29674
 gacctcaggtgatccacccacctcagcctcccaaagtgctgggattacaagcgtgagcca       c.*1140

          .         .         .         .         .         .       g.29734
 ctgtgcctggcccttttttttttttttttttttttttttaaagagatggcatcttgctat       c.*1200

          .         .         .         .         .         .       g.29794
 gtcgtccaggctggtcttgaactcctgagttcaagcagtcctcctgcttcaacatacagc       c.*1260

          .         .         .         .         .         .       g.29854
 tacaggtaccccccactatacatttttaataaggattcatggctcagagggattttctga       c.*1320

          .         .         .         .         .         .       g.29914
 tggttttgctgatttgtttctagtttttttgtgtttatatttaacatgaagaccaagttt       c.*1380

          .         .         .         .         .         .       g.29974
 atataactaggtatctgtataatgcaacaacattggaacacaataaagatgtatttttgt       c.*1440

                                                                    g.29977
 aaa                                                                c.*1443

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Folliculin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-18 Build 18
©2004-2009 Leiden University Medical Center