MYO7A (MYO7A) - coding DNA reference sequence

(used for mutation description)

(last modified February 17, 2010)


This file was created to facilitate the description of sequence variants in the MYO7A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering MYO7A transcript NM_000260.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.33
                             gctctgggcaggagagagagggagagacaaga       c.-241

 .         .         .         .         .         .                g.93
 gacacacacagagagacggcgaggaagggaaagacccagagggacgcctagaacgagact       c.-181

 .         .         .         .         .         .                g.153
 tggagccagacagaggaagaggggacgtgtgtttgcagactggctgggcccgtgacccag       c.-121

 .         .         .         .         .         .                g.213
 cttcctgagtcctccgtgcaggtggcagctgtaccaggctggcaggtcactgagagtggg       c.-61

 .         .    | 02    .         .         .         .             g.2372
 cagctgggccccag | aactgtgcctggcccagtgggcagcaggagctcctgacttgggacc    c.-1

          .         | 03         .         .         .         .    g.14488
 ATGGTGATTCTTCAGCAG | GGGGACCATGTGTGGATGGACCTGAGATTGGGGCAGGAGTTC    c.60
 M  V  I  L  Q  Q   | G  D  H  V  W  M  D  L  R  L  G  Q  E  F      p.20

          .         .         .         .         .         .       g.14548
 GACGTGCCCATCGGGGCGGTGGTGAAGCTCTGCGACTCTGGGCAGGTCCAGGTGGTGGAT       c.120
 D  V  P  I  G  A  V  V  K  L  C  D  S  G  Q  V  Q  V  V  D         p.40

          .   | 04     .         .         .         .         .    g.19583
 GATGAAGACAAT | GAACACTGGATCTCTCCGCAGAACGCAACGCACATCAAGCCTATGCAC    c.180
 D  E  D  N   | E  H  W  I  S  P  Q  N  A  T  H  I  K  P  M  H      p.60

          .         .         .         .         .         .       g.19643
 CCCACGTCGGTCCACGGCGTGGAGGACATGATCCGCCTGGGGGACCTCAACGAGGCGGGC       c.240
 P  T  S  V  H  G  V  E  D  M  I  R  L  G  D  L  N  E  A  G         p.80

          .         .         .         .      | 05  .         .    g.27659
 ATCTTGCGCAACCTGCTTATCCGCTACCGGGACCACCTCATCTAC | ACGTATACGGGCTCC    c.300
 I  L  R  N  L  L  I  R  Y  R  D  H  L  I  Y   | T  Y  T  G  S      p.100

          .         .         .         .         .         .       g.27719
 ATCCTGGTGGCTGTGAACCCCTACCAGCTGCTCTCCATCTACTCGCCAGAGCACATCCGC       c.360
 I  L  V  A  V  N  P  Y  Q  L  L  S  I  Y  S  P  E  H  I  R         p.120

          .         .         .         .         .         .       g.27779
 CAGTATACCAACAAGAAGATTGGGGAGATGCCCCCCCACATCTTTGCCATTGCTGACAAC       c.420
 Q  Y  T  N  K  K  I  G  E  M  P  P  H  I  F  A  I  A  D  N         p.140

          .         .         .         .         . | 06       .    g.28407
 TGCTACTTCAACATGAAACGCAACAGCCGAGACCAGTGCTGCATCATCAG | TGGGGAATCT    c.480
 C  Y  F  N  M  K  R  N  S  R  D  Q  C  C  I  I  S  |  G  E  S      p.160

          .         .         .         .         .         .       g.28467
 GGGGCCGGGAAGACGGAGAGCACAAAGCTGATCCTGCAGTTCCTGGCAGCCATCAGTGGG       c.540
 G  A  G  K  T  E  S  T  K  L  I  L  Q  F  L  A  A  I  S  G         p.180

          .         .         .         .         .   | 07     .    g.28607
 CAGCACTCGTGGATTGAGCAGCAGGTCTTGGAGGCCACCCCCATTCTGGAAG | CATTTGGG    c.600
 Q  H  S  W  I  E  Q  Q  V  L  E  A  T  P  I  L  E  A |   F  G      p.200

          .         .         .         .         .         .       g.28667
 AATGCCAAGACCATCCGCAATGACAACTCAAGCCGTTTCGGAAAGTACATCGACATCCAC       c.660
 N  A  K  T  I  R  N  D  N  S  S  R  F  G  K  Y  I  D  I  H         p.220

          .         .         .         .         .         .       g.28727
 TTCAACAAGCGGGGCGCCATCGAGGGCGCGAAGATTGAGCAGTACCTGCTGGAAAAGTCA       c.720
 F  N  K  R  G  A  I  E  G  A  K  I  E  Q  Y  L  L  E  K  S         p.240

          .      | 08  .         .         .         .         .    g.29061
 CGTGTCTGTCGCCAG | GCCCTGGATGAAAGGAACTACCACGTGTTCTACTGCATGCTGGAG    c.780
 R  V  C  R  Q   | A  L  D  E  R  N  Y  H  V  F  Y  C  M  L  E      p.260

          .         .         .         .         .         .       g.29121
 GGTATGAGTGAGGATCAGAAGAAGAAGCTGGGCTTGGGCCAGGCCTCTGACTACAACTAC       c.840
 G  M  S  E  D  Q  K  K  K  L  G  L  G  Q  A  S  D  Y  N  Y         p.280

           | 09        .         .         .         .         .    g.30065
 TTGGCCATG | GGTAACTGCATAACCTGTGAGGGCCGGGTGGACAGCCAGGAGTACGCCAAC    c.900
 L  A  M   | G  N  C  I  T  C  E  G  R  V  D  S  Q  E  Y  A  N      p.300

          .         .         .         .         .         .       g.30125
 ATCCGCTCCGCCATGAAGGTGCTCATGTTCACTGACACCGAGAACTGGGAGATCTCGAAG       c.960
 I  R  S  A  M  K  V  L  M  F  T  D  T  E  N  W  E  I  S  K         p.320

          .         .         .         .    | 10    .         .    g.31201
 CTCCTGGCTGCCATCCTGCACCTGGGCAACCTGCAGTATGAGG | CACGCACATTTGAAAAC    c.1020
 L  L  A  A  I  L  H  L  G  N  L  Q  Y  E  A |   R  T  F  E  N      p.340

          .         .         .         .         .         .       g.31261
 CTGGATGCCTGTGAGGTTCTCTTCTCCCCATCGCTGGCCACAGCTGCATCCCTGCTTGAG       c.1080
 L  D  A  C  E  V  L  F  S  P  S  L  A  T  A  A  S  L  L  E         p.360

  | 11       .         .         .         .         .         .    g.31960
  | GTGAACCCCCCAGACCTGATGAGCTGCCTGACTAGCCGCACCCTCATCACCCGCGGGGAG    c.1140
  | V  N  P  P  D  L  M  S  C  L  T  S  R  T  L  I  T  R  G  E      p.380

          .         .         .         .         .         .       g.32020
 ACGGTGTCCACCCCACTGAGCAGGGAACAGGCACTGGACGTGCGCGACGCCTTCGTAAAG       c.1200
 T  V  S  T  P  L  S  R  E  Q  A  L  D  V  R  D  A  F  V  K         p.400

  | 12       .         .         .         .         .         .    g.32770
  | GGGATCTACGGGCGGCTGTTCGTGTGGATTGTGGACAAGATCAACGCAGCAATTTACAAG    c.1260
  | G  I  Y  G  R  L  F  V  W  I  V  D  K  I  N  A  A  I  Y  K      p.420

          .         .         .         .         .         .       g.32830
 CCTCCCTCCCAGGATGTGAAGAACTCTCGCAGGTCCATCGGCCTCCTGGACATCTTTGGG       c.1320
 P  P  S  Q  D  V  K  N  S  R  R  S  I  G  L  L  D  I  F  G         p.440

          .         .    | 13    .         .         .         .    g.33894
 TTTGAGAACTTTGCTGTGAACAG | CTTTGAGCAGCTCTGCATCAACTTCGCCAATGAGCAC    c.1380
 F  E  N  F  A  V  N  S  |  F  E  Q  L  C  I  N  F  A  N  E  H      p.460

          .         .         .         .         .         .       g.33954
 CTGCAGCAGTTCTTTGTGCGGCACGTGTTCAAGCTGGAGCAGGAGGAATATGACCTGGAG       c.1440
 L  Q  Q  F  F  V  R  H  V  F  K  L  E  Q  E  E  Y  D  L  E         p.480

          .         .         .         .         .         .       g.34014
 AGCATTGACTGGCTGCACATCGAGTTCACTGACAACCAGGATGCCCTGGACATGATTGCC       c.1500
 S  I  D  W  L  H  I  E  F  T  D  N  Q  D  A  L  D  M  I  A         p.500

          .         .         .         .         .     | 14   .    g.34596
 AACAAGCCCATGAACATCATCTCCCTCATCGATGAGGAGAGCAAGTTCCCCAAG | GGCACA    c.1560
 N  K  P  M  N  I  I  S  L  I  D  E  E  S  K  F  P  K   | G  T      p.520

          .         .         .         .         .         .       g.34656
 GACACCACCATGTTACACAAGCTGAACTCCCAGCACAAGCTCAACGCCAACTACATCCCC       c.1620
 D  T  T  M  L  H  K  L  N  S  Q  H  K  L  N  A  N  Y  I  P         p.540

          .         .         .         .         .         .       g.34716
 CCCAAGAACAACCATGAGACCCAGTTTGGCATCAACCATTTTGCAGGCATCGTCTACTAT       c.1680
 P  K  N  N  H  E  T  Q  F  G  I  N  H  F  A  G  I  V  Y  Y         p.560

          . | 15       .         .         .         .         .    g.37843
 GAGACCCAAG | GCTTCCTGGAGAAGAACCGAGACACCCTGCATGGGGACATTATCCAGCTG    c.1740
 E  T  Q  G |   F  L  E  K  N  R  D  T  L  H  G  D  I  I  Q  L      p.580

          .         .         .         .         .        | 16.    g.44488
 GTCCACTCCTCCAGGAACAAGTTCATCAAGCAGATCTTCCAGGCCGATGTCGCCATG | GGC    c.1800
 V  H  S  S  R  N  K  F  I  K  Q  I  F  Q  A  D  V  A  M   | G      p.600

          .         .         .         .         .         .       g.44548
 GCCGAGACCAGGAAGCGCTCGCCCACACTTAGCAGCCAGTTCAAGCGGTCACTGGAGCTG       c.1860
 A  E  T  R  K  R  S  P  T  L  S  S  Q  F  K  R  S  L  E  L         p.620

          .         .         .         .         .         .       g.44608
 CTGATGCGCACGCTGGGTGCCTGCCAGCCCTTCTTTGTGCGATGCATCAAGCCCAATGAG       c.1920
 L  M  R  T  L  G  A  C  Q  P  F  F  V  R  C  I  K  P  N  E         p.640

          .      | 17  .         .         .         .         .    g.46538
 TTCAAGAAGCCCATG | CTGTTCGACCGGCACCTGTGCGTGCGCCAGCTGCGGTACTCAGGA    c.1980
 F  K  K  P  M   | L  F  D  R  H  L  C  V  R  Q  L  R  Y  S  G      p.660

          .         .         .         .         .         .       g.46598
 ATGATGGAGACCATCCGAATCCGCCGAGCTGGCTACCCCATCCGCTACAGCTTCGTAGAG       c.2040
 M  M  E  T  I  R  I  R  R  A  G  Y  P  I  R  Y  S  F  V  E         p.680

          .         .         .         .         .     | 18   .    g.47115
 TTTGTGGAGCGGTACCGTGTGCTGCTGCCAGGTGTGAAGCCGGCCTACAAGCAG | GGCGAC    c.2100
 F  V  E  R  Y  R  V  L  L  P  G  V  K  P  A  Y  K  Q   | G  D      p.700

          .         .         .         .         .         .       g.47175
 CTCCGCGGGACTTGCCAGCGCATGGCTGAGGCTGTGCTGGGCACCCACGATGACTGGCAG       c.2160
 L  R  G  T  C  Q  R  M  A  E  A  V  L  G  T  H  D  D  W  Q         p.720

          .         .        | 19.         .         .         .    g.49319
 ATAGGCAAAACCAAGATCTTTCTGAAG | GACCACCATGACATGCTGCTGGAAGTGGAGCGG    c.2220
 I  G  K  T  K  I  F  L  K   | D  H  H  D  M  L  L  E  V  E  R      p.740

          .         .         .         .         .         .       g.49379
 GACAAAGCCATCACCGACAGAGTCATCCTCCTTCAGAAAGTCATCCGGGGATTCAAAGAC       c.2280
 D  K  A  I  T  D  R  V  I  L  L  Q  K  V  I  R  G  F  K  D         p.760

    | 20     .         .         .         .         .         .    g.50840
 AG | GTCTAACTTTCTGAAGCTGAAGAACGCTGCCACACTGATCCAGAGGCACTGGCGGGGT    c.2340
 R  |  S  N  F  L  K  L  K  N  A  A  T  L  I  Q  R  H  W  R  G      p.780

          .         .        | 21.         .         .         .    g.51505
 CACAACTGTAGGAAGAACTACGGGCTG | ATGCGTCTGGGCTTCCTGCGGCTGCAGGCCCTG    c.2400
 H  N  C  R  K  N  Y  G  L   | M  R  L  G  F  L  R  L  Q  A  L      p.800

          .         .         .         .         .         .       g.51565
 CACCGCTCCCGGAAGCTGCACCAGCAGTACCGCCTGGCCCGCCAGCGCATCATCCAGTTC       c.2460
 H  R  S  R  K  L  H  Q  Q  Y  R  L  A  R  Q  R  I  I  Q  F         p.820

          .         .         .         .         .         .       g.51625
 CAGGCCCGCTGCCGCGCCTATCTGGTGCGCAAGGCCTTCCGCCACCGCCTCTGGGCTGTG       c.2520
 Q  A  R  C  R  A  Y  L  V  R  K  A  F  R  H  R  L  W  A  V         p.840

          .         .         .         .         .         .       g.51685
 CTCACCGTGCAGGCCTATGCCCGGGGCATGATCGCCCGCAGGCTGCACCAACGCCTCAGG       c.2580
 L  T  V  Q  A  Y  A  R  G  M  I  A  R  R  L  H  Q  R  L  R         p.860

        | 22 .         .         .         .         .         .    g.52165
 GCTGAG | TATCTGTGGCGCCTCGAGGCTGAGAAAATGCGGCTGGCGGAGGAAGAGAAGCTT    c.2640
 A  E   | Y  L  W  R  L  E  A  E  K  M  R  L  A  E  E  E  K  L      p.880

          .         .         .         .         .     | 23   .    g.53123
 CGGAAGGAGATGAGCGCCAAGAAGGCCAAGGAGGAGGCCGAGCGCAAGCATCAG | GAGCGC    c.2700
 R  K  E  M  S  A  K  K  A  K  E  E  A  E  R  K  H  Q   | E  R      p.900

          .         .         .         .         .         .       g.53183
 CTGGCCCAGCTGGCTCGTGAGGACGCTGAGCGGGAGCTGAAGGAGAAGGAGGCCGCTCGG       c.2760
 L  A  Q  L  A  R  E  D  A  E  R  E  L  K  E  K  E  A  A  R         p.920

          .         .         .         .         .         .       g.53243
 CGGAAGAAGGAGCTCCTGGAGCAGATGGAAAGGGCCCGCCATGAGCCTGTCAATCACTCA       c.2820
 R  K  K  E  L  L  E  Q  M  E  R  A  R  H  E  P  V  N  H  S         p.940

          .         .         .         .         .         .       g.53303
 GACATGGTGGACAAGATGTTTGGCTTCCTGGGGACTTCAGGTGGCCTGCCAGGCCAGGAG       c.2880
 D  M  V  D  K  M  F  G  F  L  G  T  S  G  G  L  P  G  Q  E         p.960

          .         .     | 24   .         .         .         .    g.53724
 GGCCAGGCACCTAGTGGCTTTGAG | GACCTGGAGCGAGGGCGGAGGGAGATGGTGGAGGAG    c.2940
 G  Q  A  P  S  G  F  E   | D  L  E  R  G  R  R  E  M  V  E  E      p.980

          .         .         .         .         .         .       g.53784
 GACCTGGATGCAGCCCTGCCCCTGCCTGACGAGGATGAGGAGGACCTCTCTGAGTATAAA       c.3000
 D  L  D  A  A  L  P  L  P  D  E  D  E  E  D  L  S  E  Y  K         p.1000

          .         .         .         .         .         .       g.53844
 TTTGCCAAGTTCGCGGCCACCTACTTCCAGGGGACAACCACGCACTCCTACACCCGGCGG       c.3060
 F  A  K  F  A  A  T  Y  F  Q  G  T  T  T  H  S  Y  T  R  R         p.1020

          .         .         .         .         | 25         .    g.54172
 CCACTCAAACAGCCACTGCTCTACCATGACGACGAGGGTGACCAGCTG | GCAGCCCTGGCG    c.3120
 P  L  K  Q  P  L  L  Y  H  D  D  E  G  D  Q  L   | A  A  L  A      p.1040

          .         .         .         .         .         .       g.54232
 GTCTGGATCACCATCCTCCGCTTCATGGGGGACCTCCCTGAGCCCAAGTACCACACAGCC       c.3180
 V  W  I  T  I  L  R  F  M  G  D  L  P  E  P  K  Y  H  T  A         p.1060

          .         .         .         .         .         .       g.54292
 ATGAGTGATGGCAGTGAGAAGATCCCTGTGATGACCAAGATTTATGAGACCCTGGGCAAG       c.3240
 M  S  D  G  S  E  K  I  P  V  M  T  K  I  Y  E  T  L  G  K         p.1080

          .         .         .         .      | 26  .         .    g.54819
 AAGACGTACAAGAGGGAGCTGCAGGCCCTGCAGGGCGAGGGCGAG | GCCCAGCTCCCCGAG    c.3300
 K  T  Y  K  R  E  L  Q  A  L  Q  G  E  G  E   | A  Q  L  P  E      p.1100

          .         .         .         .         .         .       g.54879
 GGCCAGAAGAAGAGCAGTGTGAGGCACAAGCTGGTGCATTTGACTCTGAAAAAGAAGTCC       c.3360
 G  Q  K  K  S  S  V  R  H  K  L  V  H  L  T  L  K  K  K  S         p.1120

          .      | 27  .         .         .         .         .    g.56369
 AAGCTCACAGAGGAG | GTGACCAAGAGGCTGCATGACGGGGAGTCCACAGTGCAGGGCAAC    c.3420
 K  L  T  E  E   | V  T  K  R  L  H  D  G  E  S  T  V  Q  G  N      p.1140

          .         .         .         .         .         .       g.56429
 AGCATGCTGGAGGACCGGCCCACCTCCAACCTGGAGAAGCTGCACTTCATCATCGGCAAT       c.3480
 S  M  L  E  D  R  P  T  S  N  L  E  K  L  H  F  I  I  G  N         p.1160

          .         .    | 28    .         .         .         .    g.61117
 GGCATCCTGCGGCCAGCACTCCG | GGACGAGATCTACTGCCAGATCAGCAAGCAGCTGACC    c.3540
 G  I  L  R  P  A  L  R  |  D  E  I  Y  C  Q  I  S  K  Q  L  T      p.1180

          .         .         .         .         .         .       g.61177
 CACAACCCCTCCAAGAGCAGCTATGCCCGGGGCTGGATTCTCGTGTCTCTCTGCGTGGGC       c.3600
 H  N  P  S  K  S  S  Y  A  R  G  W  I  L  V  S  L  C  V  G         p.1200

          .         .         . | 29       .         .         .    g.61786
 TGTTTCGCCCCCTCCGAGAAGTTTGTCAAG | TACCTGCGGAACTTCATCCACGGGGGCCCG    c.3660
 C  F  A  P  S  E  K  F  V  K   | Y  L  R  N  F  I  H  G  G  P      p.1220

          .         .         .         .         .         .       g.61846
 CCCGGCTACGCCCCGTACTGTGAGGAGCGCCTGAGAAGGACCTTTGTCAATGGGACACGG       c.3720
 P  G  Y  A  P  Y  C  E  E  R  L  R  R  T  F  V  N  G  T  R         p.1240

          .         .         . | 30       .         .         .    g.62463
 ACACAGCCGCCCAGCTGGCTGGAGCTGCAG | GCCACCAAGTCCAAGAAGCCAATCATGTTG    c.3780
 T  Q  P  P  S  W  L  E  L  Q   | A  T  K  S  K  K  P  I  M  L      p.1260

          .         .         .         .         .         .       g.62523
 CCCGTGACATTCATGGATGGGACCACCAAGACCCTGCTGACGGACTCGGCAACCACGGCC       c.3840
 P  V  T  F  M  D  G  T  T  K  T  L  L  T  D  S  A  T  T  A         p.1280

          .         .         .         .         .         .       g.62583
 AAGGAGCTCTGCAACGCGCTGGCCGACAAGATCTCTCTCAAGGACCGGTTCGGGTTCTCC       c.3900
 K  E  L  C  N  A  L  A  D  K  I  S  L  K  D  R  F  G  F  S         p.1300

          .         .     | 31   .         .         .         .    g.63823
 CTCTACATTGCCCTGTTTGACAAG | GTGTCCTCCCTGGGCAGCGGCAGTGACCACGTCATG    c.3960
 L  Y  I  A  L  F  D  K   | V  S  S  L  G  S  G  S  D  H  V  M      p.1320

          .         .         .         .         .         .       g.63883
 GACGCCATCTCCCAGTGCGAGCAGTACGCCAAGGAGCAGGGCGCCCAGGAGCGCAACGCC       c.4020
 D  A  I  S  Q  C  E  Q  Y  A  K  E  Q  G  A  Q  E  R  N  A         p.1340

          .         .         .         .         .         .       g.63943
 CCCTGGAGGCTCTTCTTCCGCAAAGAGGTCTTCACGCCCTGGCACAGCCCCTCCGAGGAC       c.4080
 P  W  R  L  F  F  R  K  E  V  F  T  P  W  H  S  P  S  E  D         p.1360

          .         .         .         .         .         .       g.64003
 AACGTGGCCACCAACCTCATCTACCAGCAGGTGGTGCGAGGAGTCAAGTTTGGGGAGTAC       c.4140
 N  V  A  T  N  L  I  Y  Q  Q  V  V  R  G  V  K  F  G  E  Y         p.1380

          .   | 32     .         .         .         .         .    g.66138
 AGGTGTGAGAAG | GAGGACGACCTGGCTGAGCTGGCCTCCCAGCAGTACTTTGTAGACTAT    c.4200
 R  C  E  K   | E  D  D  L  A  E  L  A  S  Q  Q  Y  F  V  D  Y      p.1400

          .         .         .         .         .         .       g.66198
 GGCTCTGAGATGATCCTGGAGCGCCTCCTGAACCTCGTGCCCACCTACATCCCCGACCGC       c.4260
 G  S  E  M  I  L  E  R  L  L  N  L  V  P  T  Y  I  P  D  R         p.1420

          .         .         .         .         .         .       g.66258
 GAGATCACGCCCCTGAAGACGCTGGAGAAGTGGGCCCAGCTGGCCATCGCCGCCCACAAG       c.4320
 E  I  T  P  L  K  T  L  E  K  W  A  Q  L  A  I  A  A  H  K         p.1440

     | 33    .         .         .         .         .         .    g.69274
 AAG | GGGATTTATGCCCAGAGGAGAACTGATGCCCAGAAGGTCAAAGAGGATGTGGTCAGT    c.4380
 K   | G  I  Y  A  Q  R  R  T  D  A  Q  K  V  K  E  D  V  V  S      p.1460

          .         .         .         .         .         .       g.69334
 TATGCCCGCTTCAAGTGGCCCTTGCTCTTCTCCAGGTTTTATGAAGCCTACAAATTCTCA       c.4440
 Y  A  R  F  K  W  P  L  L  F  S  R  F  Y  E  A  Y  K  F  S         p.1480

   | 34      .         .         .         .         .         .    g.70290
 G | GCCCCAGTCTCCCCAAGAACGACGTCATCGTGGCCGTCAACTGGACGGGTGTGTACTTT    c.4500
 G |   P  S  L  P  K  N  D  V  I  V  A  V  N  W  T  G  V  Y  F      p.1500

          .         .         .         .         .         .       g.70350
 GTGGATGAGCAGGAGCAGGTACTTCTGGAGCTGTCCTTCCCAGAGATCATGGCCGTGTCC       c.4560
 V  D  E  Q  E  Q  V  L  L  E  L  S  F  P  E  I  M  A  V  S         p.1520

          | 35         .         .         .         .         .    g.71323
 AGCAGCAG | GGAGTGCCGTGTCTGGCTCTCACTGGGCTGCTCTGATCTTGGCTGTGCTGCG    c.4620
 S  S  R  |  E  C  R  V  W  L  S  L  G  C  S  D  L  G  C  A  A      p.1540

          .         .         .         .         .         .       g.71383
 CCTCACTCAGGCTGGGCAGGACTGACCCCGGCGGGGCCCTGTTCTCCGTGTTGGTCCTGC       c.4680
 P  H  S  G  W  A  G  L  T  P  A  G  P  C  S  P  C  W  S  C         p.1560

          .         .         .         .         .         .       g.71443
 AGGGGAGCGAAAACGACGGCCCCCAGCTTCACGCTGGCCACCATCAAGGGGGACGAATAC       c.4740
 R  G  A  K  T  T  A  P  S  F  T  L  A  T  I  K  G  D  E  Y         p.1580

          .         .         .         .         .         .       g.71503
 ACCTTCACCTCCAGCAATGCTGAGGACATTCGTGACCTGGTGGTCACCTTCCTAGAGGGG       c.4800
 T  F  T  S  S  N  A  E  D  I  R  D  L  V  V  T  F  L  E  G         p.1600

          .         .         .         .         .   | 36     .    g.73192
 CTCCGGAAGAGATCTAAGTATGTTGTGGCCCTGCAGGATAACCCCAACCCCG | CAGGCGAG    c.4860
 L  R  K  R  S  K  Y  V  V  A  L  Q  D  N  P  N  P  A |   G  E      p.1620

          .         .         .         .         .         .       g.73252
 GAGTCAGGCTTCCTCAGCTTTGCCAAGGGAGACCTCATCATCCTGGACCATGACACGGGC       c.4920
 E  S  G  F  L  S  F  A  K  G  D  L  I  I  L  D  H  D  T  G         p.1640

          .         .         .         .         .         .       g.73312
 GAGCAGGTCATGAACTCGGGCTGGGCCAACGGCATCAATGAGAGGACCAAGCAGCGTGGG       c.4980
 E  Q  V  M  N  S  G  W  A  N  G  I  N  E  R  T  K  Q  R  G         p.1660

          .         .         .         .         .         .       g.73372
 GACTTCCCCACCGACAGTGTGTACGTCATGCCCACTGTCACCATGCCACCGCGGGAGATT       c.5040
 D  F  P  T  D  S  V  Y  V  M  P  T  V  T  M  P  P  R  E  I         p.1680

     | 37    .         .         .         .         .         .    g.74093
 GTG | GCCCTGGTCACCATGACTCCCGATCAGAGGCAGGACGTTGTCCGGCTCTTGCAGCTG    c.5100
 V   | A  L  V  T  M  T  P  D  Q  R  Q  D  V  V  R  L  L  Q  L      p.1700

          .         .         .         .         .         .       g.74153
 CGAACGGCGGAGCCCGAGGTGCGTGCCAAGCCCTACACGCTGGAGGAGTTTTCCTATGAC       c.5160
 R  T  A  E  P  E  V  R  A  K  P  Y  T  L  E  E  F  S  Y  D         p.1720

          | 38         .         .         .         .         .    g.74848
 TACTTCAG | GCCCCCACCCAAGCACACGCTGAGCCGTGTCATGGTGTCCAAGGCCCGAGGC    c.5220
 Y  F  R  |  P  P  P  K  H  T  L  S  R  V  M  V  S  K  A  R  G      p.1740

          .         .         .         .         .         .       g.74908
 AAGGACCGGCTGTGGAGCCACACGCGGGAACCGCTCAAGCAGGCGCTGCTCAAGAAGCTC       c.5280
 K  D  R  L  W  S  H  T  R  E  P  L  K  Q  A  L  L  K  K  L         p.1760

          .         .         .         .      | 39  .         .    g.75826
 CTGGGCAGTGAGGAGCTCTCGCAGGAGGCCTGCCTGGCCTTCATT | GCTGTGCTCAAGTAC    c.5340
 L  G  S  E  E  L  S  Q  E  A  C  L  A  F  I   | A  V  L  K  Y      p.1780

          .         .         .         .         .         .       g.75886
 ATGGGCGACTACCCGTCCAAGAGGACACGCTCCGTCAACGAGCTCACCGACCAGATCTTT       c.5400
 M  G  D  Y  P  S  K  R  T  R  S  V  N  E  L  T  D  Q  I  F         p.1800

          .         .         .         .         .         .       g.75946
 GAGGGTCCCCTGAAAGCCGAGCCCCTGAAGGACGAGGCATATGTGCAGATCCTGAAGCAG       c.5460
 E  G  P  L  K  A  E  P  L  K  D  E  A  Y  V  Q  I  L  K  Q         p.1820

          .         . | 40       .         .         .         .    g.77238
 CTGACCGACAACCACATCAG | GTACAGCGAGGAGCGGGGTTGGGAGCTGCTCTGGCTGTGC    c.5520
 L  T  D  N  H  I  R  |  Y  S  E  E  R  G  W  E  L  L  W  L  C      p.1840

          .         .         .         .         .         .       g.77298
 ACGGGCCTTTTCCCACCCAGCAACATCCTCCTGCCCCACGTGCAGCGCTTCCTGCAGTCC       c.5580
 T  G  L  F  P  P  S  N  I  L  L  P  H  V  Q  R  F  L  Q  S         p.1860

          .         .         .         .         .       | 41 .    g.77837
 CGAAAGCACTGCCCACTCGCCATCGACTGCCTGCAACGGCTCCAGAAAGCCCTGAG | AAAC    c.5640
 R  K  H  C  P  L  A  I  D  C  L  Q  R  L  Q  K  A  L  R  |  N      p.1880

          .         .         .         .         .         .       g.77897
 GGGTCCCGGAAGTACCCTCCGCACCTGGTGGAGGTGGAGGCCATCCAGCACAAGACCACC       c.5700
 G  S  R  K  Y  P  P  H  L  V  E  V  E  A  I  Q  H  K  T  T         p.1900

          .         .         .         .   | 42     .         .    g.79043
 CAGATTTTCCACAAAGTCTACTTCCCTGATGACACTGACGAG | GCCTTCGAAGTGGAGTCC    c.5760
 Q  I  F  H  K  V  Y  F  P  D  D  T  D  E   | A  F  E  V  E  S      p.1920

          .         .         .         .         .         .       g.79103
 AGCACCAAGGCCAAGGACTTCTGCCAGAACATCGCCACCAGGCTGCTCCTCAAGTCCTCA       c.5820
 S  T  K  A  K  D  F  C  Q  N  I  A  T  R  L  L  L  K  S  S         p.1940

          .         .         .       | 43 .         .         .    g.80190
 GAGGGATTCAGCCTCTTTGTCAAAATTGCAGACAAG | GTCCTCAGCGTTCCTGAGAATGAC    c.5880
 E  G  F  S  L  F  V  K  I  A  D  K   | V  L  S  V  P  E  N  D      p.1960

          .         .         .         .         .         .       g.80250
 TTCTTCTTTGACTTTGTTCGACACTTGACAGACTGGATAAAGAAAGCTCGGCCCATCAAG       c.5940
 F  F  F  D  F  V  R  H  L  T  D  W  I  K  K  A  R  P  I  K         p.1980

      | 44   .         .         .         .         .         .    g.80489
 GACG | GAATTGTGCCCTCACTCACCTACCAGGTGTTCTTCATGAAGAAGCTGTGGACCACC    c.6000
 D  G |   I  V  P  S  L  T  Y  Q  V  F  F  M  K  K  L  W  T  T      p.2000

          .         .         .         .         .  | 45      .    g.82897
 ACGGTGCCAGGGAAGGATCCCATGGCCGATTCCATCTTCCACTATTACCAG | GAGTTGCCC    c.6060
 T  V  P  G  K  D  P  M  A  D  S  I  F  H  Y  Y  Q   | E  L  P      p.2020

          .         .         .         .         .         .       g.82957
 AAGTATCTCCGAGGCTACCACAAGTGCACGCGGGAGGAGGTGCTGCAGCTGGGGGCGCTG       c.6120
 K  Y  L  R  G  Y  H  K  C  T  R  E  E  V  L  Q  L  G  A  L         p.2040

          .         .         .         .         .         .       g.83017
 ATCTACAGGGTCAAGTTCGAGGAGGACAAGTCCTACTTCCCCAGCATCCCCAAGCTGCTG       c.6180
 I  Y  R  V  K  F  E  E  D  K  S  Y  F  P  S  I  P  K  L  L         p.2060

          .         .         .         .         .        | 46.    g.83560
 CGGGAGCTGGTGCCCCAGGACCTTATCCGGCAGGTCTCACCTGATGACTGGAAGCGG | TCC    c.6240
 R  E  L  V  P  Q  D  L  I  R  Q  V  S  P  D  D  W  K  R   | S      p.2080

          .         .         .         .         .         .       g.83620
 ATCGTCGCCTACTTCAACAAGCACGCAGGGAAGTCCAAGGAGGAGGCCAAGCTGGCCTTC       c.6300
 I  V  A  Y  F  N  K  H  A  G  K  S  K  E  E  A  K  L  A  F         p.2100

          .         .         .         .         .     | 47   .    g.84694
 CTGAAGCTCATCTTCAAGTGGCCCACCTTTGGCTCAGCCTTCTTCGAGGTGAAG | CAAACT    c.6360
 L  K  L  I  F  K  W  P  T  F  G  S  A  F  F  E  V  K   | Q  T      p.2120

          .         .         .         .         .         .       g.84754
 ACGGAGCCAAACTTCCCTGAGATCCTCCTAATTGCCATCAACAAGTATGGGGTCAGCCTC       c.6420
 T  E  P  N  F  P  E  I  L  L  I  A  I  N  K  Y  G  V  S  L         p.2140

          .         | 48         .         .         .         .    g.85638
 ATCGATCCCAAAACGAAG | GATATCCTCACCACTCATCCCTTCACCAAGATCTCCAACTGG    c.6480
 I  D  P  K  T  K   | D  I  L  T  T  H  P  F  T  K  I  S  N  W      p.2160

          .         .         .         .         .         .       g.85698
 AGCAGCGGCAACACCTACTTCCACATCACCATTGGGAACTTGGTGCGCGGGAGCAAACTG       c.6540
 S  S  G  N  T  Y  F  H  I  T  I  G  N  L  V  R  G  S  K  L         p.2180

          .         | 49         .         .         .         .    g.86385
 CTCTGCGAGACGTCACTG | GGCTACAAGATGGATGACCTCCTGACTTCCTACATTAGCCAG    c.6600
 L  C  E  T  S  L   | G  Y  K  M  D  D  L  L  T  S  Y  I  S  Q      p.2200

          .         .         .         .                           g.86433
 ATGCTCACAGCCATGAGCAAACAGCGGGGCTCCAGGAGCGGCAAGTGA                   c.6648
 M  L  T  A  M  S  K  Q  R  G  S  R  S  G  K  X                     p.2215

          .         .         .         .         .         .       g.86493
 acagtcacggggaggtgctggttccatgcctgctctcgaggcagcagtgggttcaggccc       c.*60

          .         .         .         .         .         .       g.86553
 atcagctacccctgcagctggggaagacttatgccatcccggcagcgaggctgggctggc       c.*120

          .         .         .         .         .         .       g.86613
 cagccaccactgactataccaactgggcctctgatgttcttccagtgaggcatctctctg       c.*180

          .         .         .         .         .         .       g.86673
 ggatgcagaacttccctccatccacccctctggcacctgggttggtctaatcctagtttg       c.*240

          .         .         .         .         .         .       g.86733
 ctgtggccttcccggttgtgagagcctgtgatccttagatgtgtctcctgtttcagacca       c.*300

          .         .         .         .         .         .       g.86793
 gccccaccatgcaacttcctttgactttctgtgtaccactgggatagaggaatcaagagg       c.*360

          .         .         .         .         .         .       g.86853
 acaatctagctctccatactttgaacaaccaaatgtgcattgaatactctgaaaccgaag       c.*420

          .         .         .         .         .         .       g.86913
 ggactggatctgcaggtgggatgagggagacagaccacttttctatattgcagtgtgaat       c.*480

          .         .         .         .         .         .       g.86973
 gctgggcccctgctcaagtctaccctgatcacctcagggcataaagcatgtttcattctc       c.*540

                                                                    g.86977
 tggc                                                               c.*544

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The MYO7A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center