clarin 1 (CLRN1) - coding DNA reference sequence

(used for mutation description)

(last modified March 2, 2010)


This file was created to facilitate the description of sequence variants in the CLRN1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering CLRN1 transcript NM_174878.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
(upstream sequence) 
           .         .         .         .         .                g.50
           ggagatacttgaaggcagtttgaaagacttgttttacagattcttagtcc       c.-241

 .         .         .         .         .         .                g.110
 aaagatttccaattagggagaagaagcagcagaaaaggagaaaagccaagtatgagtgat       c.-181

 .         .         .         .         .         .                g.170
 gatgaggccttcatctactgacatttaacctggcgagaaccgtcgatggtgaagttgcct       c.-121

 .         .         .         .         .         .                g.230
 tttcagctgggagctgtccgttcagcttccgtaataaatgcagtcaaagaggcagtccct       c.-61

 .         .         .         .         .         .                g.290
 tcccattgctcacaaaggtcttgtttttgaacctcgccctcacagaagccgtttctcatc       c.-1

          .         .         .         .         .         .       g.350
 ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGT       c.60
 M  P  S  Q  Q  K  K  I  I  F  C  M  A  G  V  F  S  F  A  C         p.20

          .         .         .         .         .         .       g.410
 GCCCTCGGAGTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGC       c.120
 A  L  G  V  V  T  A  L  G  T  P  L  W  I  K  A  T  V  L  C         p.40

          .         .         .         .         .         .       g.470
 AAAACGGGAGCTCTGCTCGTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAA       c.180
 K  T  G  A  L  L  V  N  A  S  G  Q  E  L  D  K  F  M  G  E         p.60

          .         .         .         .         .         .       g.530
 ATGCAGTACGGGCTTTTCCACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCC       c.240
 M  Q  Y  G  L  F  H  G  E  G  V  R  Q  C  G  L  G  A  R  P         p.80

          .    | 02    .         .         .         .         .    g.31284
 TTTCGGTTCTCAT | TTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAAT    c.300
 F  R  F  S  F |   F  P  D  L  L  K  A  I  P  V  S  I  H  V  N      p.100

          .         .         .         .         .         .       g.31344
 GTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATG       c.360
 V  I  L  F  S  A  I  L  I  V  L  T  M  V  G  T  A  F  F  M         p.120

          .         .         .         .         .         .       g.31404
 TACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTG       c.420
 Y  N  A  F  G  K  P  F  E  T  L  H  G  P  L  G  L  Y  L  L         p.140

          .    | 03    .         .         .         .         .    g.44844
 AGCTTCATTTCAG | GCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAA    c.480
 S  F  I  S  G |   S  C  G  C  L  V  M  I  L  F  A  S  E  V  K      p.160

          .         .         .         .         .         .       g.44904
 ATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACG       c.540
 I  H  H  L  S  E  K  I  A  N  Y  K  E  G  T  Y  V  Y  K  T         p.180

          .         .         .         .         .         .       g.44964
 CAAAGTGAAAAATATACCACCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTT       c.600
 Q  S  E  K  Y  T  T  S  F  W  V  I  F  F  C  F  F  V  H  F         p.200

          .         .         .         .         .         .       g.45024
 CTGAATGGGCTCCTAATACGACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGAC       c.660
 L  N  G  L  L  I  R  L  A  G  F  Q  F  P  F  A  K  S  K  D         p.220

          .         .         .                                     g.45063
 GCAGAAACAACTAATGTAGCTGCAGATCTAATGTACTGA                            c.699
 A  E  T  T  N  V  A  A  D  L  M  Y  X                              p.232

          .         .         .         .         .         .       g.45123
 aaggcaaacctttctataattttacaagggagtagacttgctttggtcacttttagatgt       c.*60

          .         .         .         .         .         .       g.45183
 ggttaattttgcatatccttttagtctgcatatattaaagcatcaggacccttcgtgaca       c.*120

          .         .         .         .         .         .       g.45243
 atgtttacaaattacgtactaaggatacaggctggaaagtaagggaagcagaaggaaggc       c.*180

          .         .         .         .         .         .       g.45303
 tttgaaaagttgttttatctggtgggaaattgcttgacccaggtagtcaaaggcagttga       c.*240

          .         .         .         .         .         .       g.45363
 ctagaatcgacaaattgttactccatatatatatatgtgtgtgtgtgtgtgtgtgtgtgt       c.*300

          .         .         .         .         .         .       g.45423
 gtgtaagatgtcttcctatcaaaaagatatcaaaggcacatggaatatattttaataaaa       c.*360

          .         .         .         .         .         .       g.45483
 acaaataatatctctaatatatccacacatttgttgccagatttcagaaaactgagctgc       c.*420

          .         .         .         .         .         .       g.45543
 aatcgctttcctaaaacagtagtgtattaaatgaacatctataaaatgtatcaacacaca       c.*480

          .         .         .         .         .         .       g.45603
 ttttaaaaaatttgtttaaagtatactcttaggccaggcgtggtgactcacacctgtaat       c.*540

          .         .         .         .         .         .       g.45663
 tccagcacttcaggaggccaaggtgggaagatcatttgagttcaggagttcgagttacag       c.*600

          .         .         .         .         .         .       g.45723
 cctgggcaataaagtgagaccctgtcactaacaaaattaaaaaataaaataaatataaaa       c.*660

          .         .         .         .         .         .       g.45783
 tataggctttaaaaaagcatagtcttattaaccatgtctgttggtcaaaatctgcaaact       c.*720

          .         .         .         .         .         .       g.45843
 ctaaaagaagaaaagaagaaaaaaccaagcttagggtatttttcctcccgtgcctgagtc       c.*780

          .         .         .         .         .         .       g.45903
 ccaattacattcacgacagtactttcaatgaacataattgttaggaccactgaggaatca       c.*840

          .         .         .         .         .         .       g.45963
 tgaaaaatgatctctgcttagtacatttgatgcaaaatgacttattaggggctgtttttc       c.*900

          .         .         .         .         .         .       g.46023
 tagctatagtgtctcgagtactaatatgcaattatgaaaattatattaaatctgggatta       c.*960

          .         .         .         .         .         .       g.46083
 tgacggtatcactgtatcatcttggtcttgttctggctgtcaccaagcatgacccaggtc       c.*1020

          .         .         .         .         .         .       g.46143
 aactttttttttcccctgaattacccatcaaattgatctgcagctgactaaaggccacag       c.*1080

          .         .         .         .         .         .       g.46203
 ctgagcctggaactgacccttccttcatcctcaacctgctgtcctccagaaagcaccaag       c.*1140

          .         .         .         .         .         .       g.46263
 gaaaaagcagagaatgacagcaaacagatcactaggcctctgaccacaggtgctgagtac       c.*1200

          .         .         .         .         .         .       g.46323
 tcagcagccctcatataataggtttgaaagtactccttaaaataaaacactgtttccctt       c.*1260

          .         .         .         .         .         .       g.46383
 tggaactatttacaaggatgaaacaaccgtatacctgagaaataacttgctctggtgtca       c.*1320

          .         .         .         .                           g.46432
 attcgctattcgccagcagacatcagaacacaccgagtttccagatgct                  c.*1369

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Clarin 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center