choroideremia (Rab escort protein 1) (CHM) - coding DNA reference sequence

(used for mutation description)

(last modified March 17, 2010)


This file was created to facilitate the description of sequence variants in the CHM gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering CHM transcript NM_000390.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
(upstream sequence) 
                                         .         .                g.29
                                aatagtcacatgacacgtttcccgtcaag       c.-1

          .         .         .         .          | 02        .    g.20015
 ATGGCGGATACTCTCCCTTCGGAGTTTGATGTGATCGTAATAGGGACGG | GTTTGCCTGAA    c.60
 M  A  D  T  L  P  S  E  F  D  V  I  V  I  G  T  G |   L  P  E      p.20

          .         .         .         .         .       | 03 .    g.65756
 TCCATCATTGCAGCTGCATGTTCAAGAAGTGGCCGGAGAGTTCTGCATGTTGATTC | AAGA    c.120
 S  I  I  A  A  A  C  S  R  S  G  R  R  V  L  H  V  D  S  |  R      p.40

          .         .         .         .         .         .       g.65816
 AGCTACTATGGAGGAAACTGGGCCAGTTTTAGCTTTTCAGGACTATTGTCCTGGCTAAAG       c.180
 S  Y  Y  G  G  N  W  A  S  F  S  F  S  G  L  L  S  W  L  K         p.60

           | 04        .         .         .         .         .    g.68721
 GAATACCAG | GAAAACAGTGACATTGTAAGTGACAGTCCAGTGTGGCAAGACCAGATCCTT    c.240
 E  Y  Q   | E  N  S  D  I  V  S  D  S  P  V  W  Q  D  Q  I  L      p.80

          .         .         .         .         .         .       g.68781
 GAAAATGAAGAAGCCATTGCTCTTAGCAGGAAGGACAAAACTATTCAACATGTGGAAGTA       c.300
 E  N  E  E  A  I  A  L  S  R  K  D  K  T  I  Q  H  V  E  V         p.100

          .     | 05   .         .         .         .         .    g.83554
 TTTTGTTATGCCAG | TCAGGATTTGCATGAAGATGTCGAAGAAGCTGGTGCACTGCAGAAA    c.360
 F  C  Y  A  S  |  Q  D  L  H  E  D  V  E  E  A  G  A  L  Q  K      p.120

          .         .         .         .         .         .       g.83614
 AATCATGCTCTTGTGACATCTGCAAACTCCACAGAAGCTGCAGATTCTGCCTTCCTGCCT       c.420
 N  H  A  L  V  T  S  A  N  S  T  E  A  A  D  S  A  F  L  P         p.140

          .         .         .         .         .         .       g.83674
 ACGGAGGATGAGTCATTAAGCACTATGAGCTGTGAAATGCTCACAGAACAAACTCCAAGC       c.480
 T  E  D  E  S  L  S  T  M  S  C  E  M  L  T  E  Q  T  P  S         p.160

          .         .         .         .         .         .       g.83734
 AGCGATCCAGAGAATGCGCTAGAAGTAAATGGTGCTGAAGTGACAGGGGAAAAAGAAAAC       c.540
 S  D  P  E  N  A  L  E  V  N  G  A  E  V  T  G  E  K  E  N         p.180

          .         .         .         .         .         .       g.83794
 CATTGTGATGATAAAACTTGTGTGCCATCAACTTCAGCAGAAGACATGAGTGAAAATGTG       c.600
 H  C  D  D  K  T  C  V  P  S  T  S  A  E  D  M  S  E  N  V         p.200

          .         .         .         .         .         .       g.83854
 CCTATAGCAGAAGATACCACAGAGCAACCAAAGAAAAACAGAATTACTTACTCACAAATT       c.660
 P  I  A  E  D  T  T  E  Q  P  K  K  N  R  I  T  Y  S  Q  I         p.220

          .         .         .         .   | 06     .         .    g.88601
 ATTAAAGAAGGCAGGAGATTTAATATTGATTTAGTATCAAAG | CTGCTGTATTCTCGAGGA    c.720
 I  K  E  G  R  R  F  N  I  D  L  V  S  K   | L  L  Y  S  R  G      p.240

          .         .         .         .         .         .       g.88661
 TTACTAATTGATCTTCTAATCAAATCTAATGTTAGTCGATATGCAGAGTTTAAAAATATT       c.780
 L  L  I  D  L  L  I  K  S  N  V  S  R  Y  A  E  F  K  N  I         p.260

          .         .         .          | 07        .         .    g.89606
 ACCAGGATTCTTGCATTTCGAGAAGGACGAGTGGAACAG | GTTCCGTGTTCCAGAGCAGAT    c.840
 T  R  I  L  A  F  R  E  G  R  V  E  Q   | V  P  C  S  R  A  D      p.280

          .         .         .         .         .         .       g.89666
 GTCTTTAATAGCAAACAACTTACTATGGTAGAAAAGCGAATGCTAATGAAATTTCTTACA       c.900
 V  F  N  S  K  Q  L  T  M  V  E  K  R  M  L  M  K  F  L  T         p.300

          .         .         .         . | 08       .         .    g.91202
 TTTTGTATGGAATATGAGAAATATCCTGATGAATATAAAG | GATATGAAGAGATCACATTT    c.960
 F  C  M  E  Y  E  K  Y  P  D  E  Y  K  G |   Y  E  E  I  T  F      p.320

          .         .         .         .         .         .       g.91262
 TATGAATATTTAAAGACTCAAAAATTAACCCCCAACCTCCAATATATTGTCATGCATTCA       c.1020
 Y  E  Y  L  K  T  Q  K  L  T  P  N  L  Q  Y  I  V  M  H  S         p.340

          .         .         .         .         .         .       g.91322
 ATTGCAATGACATCAGAGACAGCCAGCAGCACCATAGATGGTCTCAAAGCTACCAAAAAC       c.1080
 I  A  M  T  S  E  T  A  S  S  T  I  D  G  L  K  A  T  K  N         p.360

          .         .         .         .         .         .       g.91382
 TTTCTTCACTGTCTTGGGCGGTATGGCAACACTCCATTTTTGTTTCCTTTATATGGCCAA       c.1140
 F  L  H  C  L  G  R  Y  G  N  T  P  F  L  F  P  L  Y  G  Q         p.380

          .         .       | 09 .         .         .         .    g.136256
 GGAGAACTCCCCCAGTGTTTCTGCAG | GATGTGTGCTGTGTTTGGTGGAATTTATTGTCTT    c.1200
 G  E  L  P  Q  C  F  C  R  |  M  C  A  V  F  G  G  I  Y  C  L      p.400

          .         .         .         .     | 10   .         .    g.146388
 CGCCATTCAGTACAGTGCCTTGTAGTGGACAAAGAATCCAGAAA | ATGTAAAGCAATTATA    c.1260
 R  H  S  V  Q  C  L  V  V  D  K  E  S  R  K  |  C  K  A  I  I      p.420

          .         .         .         .         .         .       g.146448
 GATCAGTTTGGTCAGAGAATAATCTCTGAGCATTTCCTCGTGGAGGACAGTTACTTTCCT       c.1320
 D  Q  F  G  Q  R  I  I  S  E  H  F  L  V  E  D  S  Y  F  P         p.440

          .         .          | 11        .         .         .    g.146882
 GAGAACATGTGCTCACGTGTGCAATACAG | GCAGATCTCCAGGGCAGTGCTGATTACAGAT    c.1380
 E  N  M  C  S  R  V  Q  Y  R  |  Q  I  S  R  A  V  L  I  T  D      p.460

          .         .         .    | 12    .         .         .    g.153303
 AGATCTGTCCTAAAAACAGATTCAGATCAACAG | ATTTCCATTTTGACAGTGCCAGCAGAG    c.1440
 R  S  V  L  K  T  D  S  D  Q  Q   | I  S  I  L  T  V  P  A  E      p.480

          .         .         .         .         .         .       g.153363
 GAACCAGGAACTTTTGCTGTTCGGGTCATTGAGTTATGTTCTTCAACGATGACATGCATG       c.1500
 E  P  G  T  F  A  V  R  V  I  E  L  C  S  S  T  M  T  C  M         p.500

          . | 13       .         .         .         .         .    g.168547
 AAAGGCACCT | ATTTGGTTCATTTGACTTGCACATCTTCTAAAACAGCAAGAGAAGATTTA    c.1560
 K  G  T  Y |   L  V  H  L  T  C  T  S  S  K  T  A  R  E  D  L      p.520

          .         .         .         .          | 14        .    g.174359
 GAATCAGTTGTGCAGAAATTGTTTGTTCCATATACTGAAATGGAGATAG | AAAATGAACAA    c.1620
 E  S  V  V  Q  K  L  F  V  P  Y  T  E  M  E  I  E |   N  E  Q      p.540

          .         .         .         .         .         .       g.174419
 GTAGAAAAGCCAAGAATTCTGTGGGCTCTTTACTTCAATATGAGAGATTCGTCAGACATC       c.1680
 V  E  K  P  R  I  L  W  A  L  Y  F  N  M  R  D  S  S  D  I         p.560

          .         .         .         .         .         .       g.174479
 AGCAGGAGCTGTTATAATGATTTACCATCCAACGTTTATGTCTGCTCTGGCCCAGATTGT       c.1740
 S  R  S  C  Y  N  D  L  P  S  N  V  Y  V  C  S  G  P  D  C         p.580

          .         .         . | 15       .         .         .    g.182769
 GGTTTAGGAAATGATAATGCAGTCAAACAG | GCTGAAACACTTTTCCAGGAAATCTGCCCC    c.1800
 G  L  G  N  D  N  A  V  K  Q   | A  E  T  L  F  Q  E  I  C  P      p.600

          .         .         .         .         .         .       g.182829
 AATGAAGATTTCTGTCCCCCTCCACCAAATCCTGAAGACATTATCCTTGATGGAGACAGT       c.1860
 N  E  D  F  C  P  P  P  P  N  P  E  D  I  I  L  D  G  D  S         p.620

          .         .         .         .         .         .       g.182889
 TTACAGCCAGAGGCTTCAGAATCCAGTGCCATACCAGAGGCTAACTCGGAGACTTTCAAG       c.1920
 L  Q  P  E  A  S  E  S  S  A  I  P  E  A  N  S  E  T  F  K         p.640

          .         .         .         .                           g.182931
 GAAAGCACAAACCTTGGAAACCTAGAGGAGTCCTCTGAATAA                         c.1962
 E  S  T  N  L  G  N  L  E  E  S  S  E  X                           p.653

          .         .         .         .         .         .       g.182991
 tggatatacaccaaactggatacccaactttggaaattctgactggtctcagagtctact       c.*60

          .         .         .         .         .         .       g.183051
 tgatagaaggactgtttgagaaatgttagaaagcagcagcaattataaggcaaaataggt       c.*120

          .         .         .         .         .         .       g.183111
 aatagaaatccaaaaggggattttccttatagaggacattccaagaacacacaacactta       c.*180

          .         .         .         .         .         .       g.183171
 taaagcacattgacttgctcattttaaataccaaacttgtgtgactagcagatgaaaatt       c.*240

          .         .         .         .         .         .       g.183231
 ataaatcaattgattctcaggaatgtaactgtggatatgaaagtgatcctatgcattgtt       c.*300

          .         .         .         .         .         .       g.183291
 aataattccatggtcttaggacaattttgcttaccactttggatctttgtttgaaagcca       c.*360

          .         .         .         .         .         .       g.183351
 cattttcagaaccagctcatgtattttctttggttatttgaattttattttctttatgga       c.*420

          .         .         .         .         .         .       g.183411
 caagagcatcataacataatgataaaaacatatagaaaaactaaagtatcatgatctaga       c.*480

          .         .         .         .         .         .       g.183471
 tagaagcctgtatttggaatacaggtttgttttgctttctatgttgagaagcattgaaaa       c.*540

          .         .         .         .         .         .       g.183531
 tgctaatataaaggtgtttagacatttttacgaataagtcagtagtgttttttagtatca       c.*600

          .         .         .         .         .         .       g.183591
 gtagtgatatttgtttgtaaattatttacatattgggaaaggtcaataatgaagaaatga       c.*660

          .         .         .         .         .         .       g.183651
 aagaatggaaggaaaggtgtggataggctcattggtatttgaatattctgtctgtcaagt       c.*720

          .         .         .         .         .         .       g.183711
 aactagagtattaggctaattgtctacagacctaatttaatcctggctgtcctactgatg       c.*780

          .         .         .         .         .         .       g.183771
 atatttggtaaattgtttaacttctgagcctacgtttctccatatataaagtggaaatag       c.*840

          .         .         .         .         .         .       g.183831
 tattactatgcctactatatgagaatggttatgaagacaatgcaatgccatgtttagaat       c.*900

          .         .         .         .         .         .       g.183891
 cggtttgccagaagaaaattgttttagaattttcccattgacttgatgaatctcaaaagt       c.*960

          .         .         .         .         .         .       g.183951
 ctcacgcaggaaataattgcttgctgtcagtcaacttccaaacaaaatagatcacagtgt       c.*1020

          .         .         .         .         .         .       g.184011
 ttttattgcattaagctttttaaatgaaaatttcttttttaaagtagtattttatagtct       c.*1080

          .         .         .         .         .         .       g.184071
 tacagaccagtaaaaatagtaacaagtagaattgtggttttgaaatattactaaggaaaa       c.*1140

          .         .         .         .         .         .       g.184131
 cactctataaattgttttattccttttctggtaggtaaacctgcaaccaccaaggactcc       c.*1200

          .         .         .         .         .         .       g.184191
 aaattgtgtatgacagttggtaagccctaatatacactacataaaaacgttagggctgcc       c.*1260

          .         .         .         .         .         .       g.184251
 tgtaatcccagcactttgggaagctgaggtgggtagatcacttgaggtcaggagttcgag       c.*1320

          .         .         .         .         .         .       g.184311
 accagcctggccaacatggcgaaaccctgtctctactaaaaatacaaaattttagctggg       c.*1380

          .         .         .         .         .         .       g.184371
 tgttatggtgggcacctgtaatcccagctactttgaagatgaggtagcagactcacttga       c.*1440

          .         .         .         .         .         .       g.184431
 accagggaggcggaggttgcagtgagccaagattttgccactgcactccagcctgggtga       c.*1500

          .         .         .         .         .         .       g.184491
 cagagcaagactctgtctcacaaaaaaaaaaaaagggggctgtacataggcagcaaacta       c.*1560

          .         .         .         .         .         .       g.184551
 agctgcagtgatgttgcctatatttaaattttctcaaatggccaagctctgatggtctac       c.*1620

          .         .         .         .         .         .       g.184611
 tttatttgagcaatagttgagacttataattgcctataaataaacaaacaaatgaactat       c.*1680

          .         .         .         .         .         .       g.184671
 ttgtttttttttctcacaacatctggcctatattgtctgtcaggaagccatggctccaat       c.*1740

          .         .         .         .         .         .       g.184731
 gtaaagtacatagttcttacatacttcaactgcagctggtccctgacctcaccaggtttc       c.*1800

          .         .         .         .         .         .       g.184791
 agagatgttcttaaaggaagccagctgtggcaggtcacagattcatgggaaatggaaaga       c.*1860

          .         .         .         .         .         .       g.184851
 accaaggaatatagctcttgcctcacctttctacccactgcagatatagttcaagccaga       c.*1920

          .         .         .         .         .         .       g.184911
 gtaatggaagaacttaacttactagcctctcaggctgctcctatccctacctcccagtgt       c.*1980

          .         .         .         .         .         .       g.184971
 acagcccctccccatctctttagtcccctttccctcacttccccttttataatgtcacac       c.*2040

          .         .         .         .         .         .       g.185031
 aaatcagggacagtaggatcacattataacctactttgtcatagggattcgatttttctt       c.*2100

          .         .         .         .         .         .       g.185091
 atatcaaatcatgtttcctgaaacccagctggggcatatgcactcaatgtctaatacata       c.*2160

          .         .         .         .         .         .       g.185151
 cttattaatgtaccggatattggccttgcccctggatatcagcaatatattataaaaggt       c.*2220

          .         .         .         .         .         .       g.185211
 tccagtagatgagacgattgagtctgaatacaattgcagtaaattgtgccaataaagata       c.*2280

          .         .         .         .         .         .       g.185271
 ttgtactgttacggtcttagagttaaagccgcttgaatgcagcatgcacattcatgtaaa       c.*2340

          .         .         .         .         .         .       g.185331
 cagacaatcagggtaggcctagaataaccacaaaaattctattggccttactgcagccac       c.*2400

          .         .         .         .         .         .       g.185391
 ctatatgtagaacaatggaggagatagtttgtggtccattattgtaccctgtttcatcca       c.*2460

          .         .         .         .         .         .       g.185451
 ttagcatcagaatctctctttcaggtcatttattaaatatgattgaaatgtttaaaagtt       c.*2520

          .         .         .         .         .         .       g.185511
 cctgaacatgattcatgatgattaaaatatcatacaactgataaaagactttaagaactt       c.*2580

          .         .         .         .         .         .       g.185571
 tatatatttcctgttgcctcaaaatgtaacagaaattattcttagagctttgattttagc       c.*2640

          .         .         .         .         .         .       g.185631
 tatcctaattactgcaaataaatatttgttcttatagttttaaatcaaaaagaaaagtct       c.*2700

          .         .         .         .         .         .       g.185691
 tgttataaaaccttaagcttgaaatcatattaataaaatatattgtacatagtggaaaat       c.*2760

          .         .         .         .         .         .       g.185751
 tttcagtagctaatttaaaatttcagaaaatgctattaaagaattttgattcaagtattt       c.*2820

          .         .         .         .         .         .       g.185811
 aaactgtttagttatgcatgcttcttattaaccgaaaatgataataccatttagtttagt       c.*2880

          .         .         .         .         .         .       g.185871
 gatcagtatgagaagcaatacctaatcctatgttgctattgtattttttcctagttggtg       c.*2940

          .         .         .         .         .         .       g.185931
 tgcctgctcagaaaaacatatactgtatgtgtatacatacctgtgtatatataaaaggtc       c.*3000

          .         .         .         .         .         .       g.185991
 aatttatatatttttctataggaaaatggagtaacaagttccctatctcccatatttatt       c.*3060

          .         .         .         .         .         .       g.186051
 tgtccatagtaaaatggccacattgatgataatttctagaactagtttctgagattgtca       c.*3120

          .         .         .         .         .         .       g.186111
 gccctttgtctaaaataatggcagtattaatgattgacttctgtcactgccatagttacc       c.*3180

          .         .         .         .         .         .       g.186171
 tggattgtcagccttggtagcctttgtctaaagtcctaaagagttccaaaaaaaatgtgt       c.*3240

          .         .         .         .         .         .       g.186231
 tgaaatttaattgctaaatagtggttggtgattctttacagtaggaattgtaataatttt       c.*3300

          .         .         .         .         .         .       g.186291
 cttgcaaataagttatttactgctattgatattgaataatttgtcttttattcagatata       c.*3360

          .         .         .         .         .         .       g.186351
 tttcaaaaagcatgaatatatgattattcataaattgtatactttaccagtaagttttca       c.*3420

          .         .         .                                     g.186381
 gaggaaataaagacttttaaatccttttca                                     c.*3450

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Choroideremia (Rab escort protein 1) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center