ATPase, Cu++ transporting, alpha polypeptide (ATP7A) - coding DNA reference sequence

(used for mutation description)

(last modified August 2, 2011)


This file was created to facilitate the description of sequence variants in the ATP7A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013224.1, covering ATP7A transcript NM_000052.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5040
                     gttgttgctgccgccgccgcagccgcagctactgtgactt       c.-121

 .         .         .         .         .         .                g.5100
 ctccgattgtgtgagctttgttggagcctgcgtacgtggatttatcgctgccacggtctg       c.-61

 .         .         .         .         | 02         .             g.65945
 cgtagctccagaggtttaaccataggatagagaaaccag | gaatgtaatgaggaaatcaaa    c.-1

          .         .         .         .         .         .       g.66005
 ATGGATCCAAGTATGGGTGTGAATTCTGTTACCATTTCTGTTGAGGGTATGACTTGCAAT       c.60
 M  D  P  S  M  G  V  N  S  V  T  I  S  V  E  G  M  T  C  N         p.20

          .         .         .         .         .         .       g.66065
 TCCTGTGTTTGGACCATTGAGCAGCAGATTGGAAAAGTGAATGGTGTGCATCACATTAAG       c.120
 S  C  V  W  T  I  E  Q  Q  I  G  K  V  N  G  V  H  H  I  K         p.40

  | 03       .         .         .         .         .         .    g.82604
  | GTATCACTGGAAGAAAAAAATGCAACTATTATTTATGACCCTAAACTACAGACTCCAAAG    c.180
  | V  S  L  E  E  K  N  A  T  I  I  Y  D  P  K  L  Q  T  P  K      p.60

          .         .         .         .         .         .       g.82664
 ACCCTACAGGAAGCTATTGATGACATGGGCTTTGATGCTGTTATCCATAATCCTGACCCT       c.240
 T  L  Q  E  A  I  D  D  M  G  F  D  A  V  I  H  N  P  D  P         p.80

          .         .         .         .         .         .       g.82724
 CTCCCTGTTTTAACTGACACCTTGTTTCTGACTGTTACGGCGTCACTGACTTTGCCATGG       c.300
 L  P  V  L  T  D  T  L  F  L  T  V  T  A  S  L  T  L  P  W         p.100

          .         .         .         .         .         .       g.82784
 GACCATATCCAAAGCACATTGCTGAAGACCAAGGGTGTGACAGACATTAAAATTTACCCT       c.360
 D  H  I  Q  S  T  L  L  K  T  K  G  V  T  D  I  K  I  Y  P         p.120

          .         .         .         .         .         .       g.82844
 CAGAAAAGAACTGTAGCAGTGACAATAATCCCTTCTATAGTGAATGCCAATCAGATAAAA       c.420
 Q  K  R  T  V  A  V  T  I  I  P  S  I  V  N  A  N  Q  I  K         p.140

          .         .         .         .         .         .       g.82904
 GAGCTGGTTCCAGAACTCAGTTTAGATACTGGGACACTGGAGAAAAAGTCAGGAGCTTGT       c.480
 E  L  V  P  E  L  S  L  D  T  G  T  L  E  K  K  S  G  A  C         p.160

          .         .         .         .         .         .       g.82964
 GAAGATCATAGTATGGCTCAAGCTGGTGAAGTCGTGCTGAAGATGAAAGTGGAAGGGATG       c.540
 E  D  H  S  M  A  Q  A  G  E  V  V  L  K  M  K  V  E  G  M         p.180

          .         .         .         .         .         .       g.83024
 ACCTGCCATTCATGTACTAGCACTATTGAAGGAAAAATTGGGAAACTGCAAGGTGTTCAG       c.600
 T  C  H  S  C  T  S  T  I  E  G  K  I  G  K  L  Q  G  V  Q         p.200

          . | 04       .         .         .         .         .    g.83585
 CGAATTAAAG | TCTCCCTGGACAATCAAGAAGCTACTATTGTTTATCAACCTCATCTTATC    c.660
 R  I  K  V |   S  L  D  N  Q  E  A  T  I  V  Y  Q  P  H  L  I      p.220

          .         .         .         .         .         .       g.83645
 TCAGTAGAGGAAATGAAAAAGCAGATTGAAGCTATGGGCTTTCCAGCATTTGTCAAAAAG       c.720
 S  V  E  E  M  K  K  Q  I  E  A  M  G  F  P  A  F  V  K  K         p.240

          .         .         .         .         .         .       g.83705
 CAGCCCAAGTACCTCAAATTGGGAGCTATTGATGTAGAACGTCTAAAGAACACACCAGTT       c.780
 Q  P  K  Y  L  K  L  G  A  I  D  V  E  R  L  K  N  T  P  V         p.260

          .         .         .         .         .         .       g.83765
 AAATCCTCAGAAGGGTCACAGCAAAGGAGTCCATCATATACCAATGATTCAACAGCCACT       c.840
 K  S  S  E  G  S  Q  Q  R  S  P  S  Y  T  N  D  S  T  A  T         p.280

          .         .         .         .         .         .       g.83825
 TTCATCATTGATGGCATGCATTGTAAATCATGTGTGTCAAATATTGAAAGTACTTTATCT       c.900
 F  I  I  D  G  M  H  C  K  S  C  V  S  N  I  E  S  T  L  S         p.300

          .         .         .         .         .         .       g.83885
 GCACTCCAATATGTAAGCAGCATAGTAGTTTCTTTAGAGAATAGGTCTGCCATTGTGAAG       c.960
 A  L  Q  Y  V  S  S  I  V  V  S  L  E  N  R  S  A  I  V  K         p.320

          .         .         .         .         .         .       g.83945
 TATAATGCAAGCTCAGTCACTCCAGAATCCCTGAGAAAAGCAATAGAGGCTGTATCACCG       c.1020
 Y  N  A  S  S  V  T  P  E  S  L  R  K  A  I  E  A  V  S  P         p.340

          .         .         .         .         .         .       g.84005
 GGGCTATATAGAGTTAGTATCACAAGTGAAGTTGAGAGTACCTCAAACTCTCCCTCCAGC       c.1080
 G  L  Y  R  V  S  I  T  S  E  V  E  S  T  S  N  S  P  S  S         p.360

          .         .         .         .         .         .       g.84065
 TCATCTCTTCAGAAGATTCCTTTGAATGTAGTTAGCCAGCCTCTGACACAAGAAACTGTG       c.1140
 S  S  L  Q  K  I  P  L  N  V  V  S  Q  P  L  T  Q  E  T  V         p.380

          .         .         .         .         .         .       g.84125
 ATAAACATTGATGGCATGACTTGTAATTCCTGTGTGCAGTCTATTGAGGGTGTCATATCA       c.1200
 I  N  I  D  G  M  T  C  N  S  C  V  Q  S  I  E  G  V  I  S         p.400

          .         .         .         .         .         .       g.84185
 AAAAAGCCAGGTGTAAAATCCATACGAGTCTCCCTTGCAAATAGCAATGGGACTGTTGAG       c.1260
 K  K  P  G  V  K  S  I  R  V  S  L  A  N  S  N  G  T  V  E         p.420

          .         .         .         .         .         .       g.84245
 TATGATCCTCTACTAACCTCTCCAGAAACGTTGAGAGGAGCAATAGAAGACATGGGATTT       c.1320
 Y  D  P  L  L  T  S  P  E  T  L  R  G  A  I  E  D  M  G  F         p.440

          .       | 05 .         .         .         .         .    g.92825
 GATGCTACCTTGTCAG | ACACGAATGAGCCGTTGGTAGTAATAGCTCAGCCTTCATCGGAA    c.1380
 D  A  T  L  S  D |   T  N  E  P  L  V  V  I  A  Q  P  S  S  E      p.460

          .         .         .         .         .         .       g.92885
 ATGCCGCTTTTGACTTCAACTAATGAATTTTATACTAAAGGGATGACACCAGTTCAAGAC       c.1440
 M  P  L  L  T  S  T  N  E  F  Y  T  K  G  M  T  P  V  Q  D         p.480

          .         .         .         .         .         .       g.92945
 AAGGAGGAAGGAAAGAATTCATCTAAGTGTTACATACAGGTCACTGGCATGACTTGCGCT       c.1500
 K  E  E  G  K  N  S  S  K  C  Y  I  Q  V  T  G  M  T  C  A         p.500

          .         .         .         .    | 06    .         .    g.97393
 TCCTGTGTAGCAAACATTGAACGGAATTTAAGGCGGGAAGAAG | GAATATATTCTATACTT    c.1560
 S  C  V  A  N  I  E  R  N  L  R  R  E  E  G |   I  Y  S  I  L      p.520

          .         .         .         .         .         .       g.97453
 GTGGCCCTGATGGCTGGCAAGGCAGAAGTAAGGTATAATCCTGCTGTTATACAACCCCCA       c.1620
 V  A  L  M  A  G  K  A  E  V  R  Y  N  P  A  V  I  Q  P  P         p.540

          .         .         .         .         .         .       g.97513
 ATGATAGCAGAGTTCATCCGAGAACTTGGATTTGGAGCCACTGTGATAGAAAATGCTGAT       c.1680
 M  I  A  E  F  I  R  E  L  G  F  G  A  T  V  I  E  N  A  D         p.560

          .         .        | 07.         .         .         .    g.103438
 GAAGGAGATGGTGTTTTGGAACTTGTT | GTGAGGGGAATGACGTGTGCCTCCTGCGTACAT    c.1740
 E  G  D  G  V  L  E  L  V   | V  R  G  M  T  C  A  S  C  V  H      p.580

          .         .         .         .         .         .       g.103498
 AAAATAGAGTCTAGTCTCACAAAACACAGAGGGATCCTATACTGCTCCGTGGCCCTGGCA       c.1800
 K  I  E  S  S  L  T  K  H  R  G  I  L  Y  C  S  V  A  L  A         p.600

          .         .         .         .         .         .       g.103558
 ACCAACAAAGCACATATTAAATATGACCCAGAAATTATTGGTCCTAGAGATATTATCCAT       c.1860
 T  N  K  A  H  I  K  Y  D  P  E  I  I  G  P  R  D  I  I  H         p.620

           | 08        .         .         .         .         .    g.105530
 ACAATTGAA | AGCTTAGGTTTTGAAGCTTCTTTGGTCAAGAAGGATCGGTCAGCAAGTCAC    c.1920
 T  I  E   | S  L  G  F  E  A  S  L  V  K  K  D  R  S  A  S  H      p.640

          .         .       | 09 .         .         .         .    g.105786
 TTAGATCATAAACGAGAAATAAGACA | ATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTC    c.1980
 L  D  H  K  R  E  I  R  Q  |  W  R  R  S  F  L  V  S  L  F  F      p.660

          .         .         .         .         .         .       g.105846
 TGTATTCCTGTAATGGGGCTGATGATATATATGATGGTTATGGACCACCACTTTGCAACT       c.2040
 C  I  P  V  M  G  L  M  I  Y  M  M  V  M  D  H  H  F  A  T         p.680

          .         .         .         .         .         .       g.105906
 CTTCACCATAATCAAAACATGAGTAAAGAAGAAATGATCAACCTTCATTCTTCTATGTTC       c.2100
 L  H  H  N  Q  N  M  S  K  E  E  M  I  N  L  H  S  S  M  F         p.700

          .         .         .         .         .         .       g.105966
 CTGGAGCGCCAGATTCTTCCAGGATTGTCTGTTATGAATTTGCTGTCCTTTTTATTGTGT       c.2160
 L  E  R  Q  I  L  P  G  L  S  V  M  N  L  L  S  F  L  L  C         p.720

          .   | 10     .         .         .         .         .    g.107230
 GTACCTGTACAG | TTTTTCGGAGGCTGGTACTTCTACATTCAGGCTTATAAAGCACTGAAG    c.2220
 V  P  V  Q   | F  F  G  G  W  Y  F  Y  I  Q  A  Y  K  A  L  K      p.740

          .         .         .         .         .         .       g.107290
 CATAAGACAGCAAATATGGACGTACTGATTGTGCTGGCAACCACCATTGCATTTGCCTAC       c.2280
 H  K  T  A  N  M  D  V  L  I  V  L  A  T  T  I  A  F  A  Y         p.760

          .         .         .         .         .         .       g.107350
 TCTTTGATTATTCTTCTAGTTGCAATGTATGAGAGAGCCAAAGTGAACCCTATTACTTTC       c.2340
 S  L  I  I  L  L  V  A  M  Y  E  R  A  K  V  N  P  I  T  F         p.780

          .         .         .         .         .         .       g.107410
 TTTGACACACCCCCTATGCTGTTTGTGTTTATTGCACTAGGCCGATGGCTGGAACATATA       c.2400
 F  D  T  P  P  M  L  F  V  F  I  A  L  G  R  W  L  E  H  I         p.800

        | 11 .         .         .         .         .         .    g.109019
 GCAAAG | GGCAAAACATCAGAGGCTCTTGCAAAGTTAATTTCACTACAAGCTACAGAAGCA    c.2460
 A  K   | G  K  T  S  E  A  L  A  K  L  I  S  L  Q  A  T  E  A      p.820

          .         .         .         | 12         .         .    g.110079
 ACTATTGTAACTCTTGATTCTGATAATATCCTCCTCAG | TGAAGAACAAGTGGATGTGGAA    c.2520
 T  I  V  T  L  D  S  D  N  I  L  L  S  |  E  E  Q  V  D  V  E      p.840

          .         .         .         .         .         .       g.110139
 CTTGTACAACGTGGAGATATCATTAAAGTAGTTCCAGGAGGCAAATTTCCAGTGGATGGT       c.2580
 L  V  Q  R  G  D  I  I  K  V  V  P  G  G  K  F  P  V  D  G         p.860

          .         .         .         .       | 13 .         .    g.114561
 CGTGTTATTGAAGGACATTCTATGGTAGATGAGTCCCTCATCACAG | GGGAGGCAATGCCT    c.2640
 R  V  I  E  G  H  S  M  V  D  E  S  L  I  T  G |   E  A  M  P      p.880

          .         .         .         .         .         .       g.114621
 GTGGCTAAGAAACCTGGCAGCACAGTGATTGCTGGTTCCATTAACCAGAACGGGTCACTG       c.2700
 V  A  K  K  P  G  S  T  V  I  A  G  S  I  N  Q  N  G  S  L         p.900

          .         .         .         .         .         .       g.114681
 CTTATCTGCGCAACACATGTTGGAGCAGACACAACCCTTTCTCAAATTGTCAAACTTGTG       c.2760
 L  I  C  A  T  H  V  G  A  D  T  T  L  S  Q  I  V  K  L  V         p.920

          .         .  | 14      .         .         .         .    g.115287
 GAAGAGGCACAAACATCAAAG | GCTCCTATCCAGCAGTTTGCAGACAAACTCAGTGGCTAT    c.2820
 E  E  A  Q  T  S  K   | A  P  I  Q  Q  F  A  D  K  L  S  G  Y      p.940

          .         .         .         .         .         .       g.115347
 TTTGTTCCTTTTATTGTTTTTGTTTCCATTGCCACCCTCTTGGTATGGATTGTAATTGGA       c.2880
 F  V  P  F  I  V  F  V  S  I  A  T  L  L  V  W  I  V  I  G         p.960

          .         .         .       | 15 .         .         .    g.123577
 TTTCTGAATTTTGAAATTGTGGAAACCTACTTTCCT | GGCTACAATAGAAGTATCTCCCGA    c.2940
 F  L  N  F  E  I  V  E  T  Y  F  P   | G  Y  N  R  S  I  S  R      p.980

          .         .         .         .         .         .       g.123637
 ACAGAAACGATAATACGATTTGCTTTCCAAGCCTCTATCACAGTTCTGTGTATTGCATGT       c.3000
 T  E  T  I  I  R  F  A  F  Q  A  S  I  T  V  L  C  I  A  C         p.1000

          .         .         .         .         .         .       g.123697
 CCCTGTTCACTGGGACTGGCCACTCCAACTGCTGTGATGGTGGGTACAGGAGTAGGTGCT       c.3060
 P  C  S  L  G  L  A  T  P  T  A  V  M  V  G  T  G  V  G  A         p.1020

          .         .         .         .         .  | 16      .    g.125713
 CAAAATGGCATACTAATAAAAGGTGGAGAGCCATTGGAGATGGCTCATAAG | GTAAAGGTA    c.3120
 Q  N  G  I  L  I  K  G  G  E  P  L  E  M  A  H  K   | V  K  V      p.1040

          .         .         .         .         .         .       g.125773
 GTGGTATTTGATAAGACTGGAACCATTACTCACGGAACCCCAGTGGTGAATCAAGTAAAG       c.3180
 V  V  F  D  K  T  G  T  I  T  H  G  T  P  V  V  N  Q  V  K         p.1060

          .         .         .         .         .         .       g.125833
 GTTCTAACTGAAAGTAACAGAATATCACACCATAAAATCTTGGCCATTGTGGGAACTGCT       c.3240
 V  L  T  E  S  N  R  I  S  H  H  K  I  L  A  I  V  G  T  A         p.1080

          .         .         .         .         .     | 17   .    g.127915
 GAAAGTAACAGTGAACACCCTCTAGGAACAGCCATAACCAAATATTGCAAACAG | GAGCTG    c.3300
 E  S  N  S  E  H  P  L  G  T  A  I  T  K  Y  C  K  Q   | E  L      p.1100

          .         .         .         .         .         .       g.127975
 GACACTGAAACCTTGGGTACCTGCATAGATTTCCAGGTTGTGCCAGGCTGTGGTATTAGC       c.3360
 D  T  E  T  L  G  T  C  I  D  F  Q  V  V  P  G  C  G  I  S         p.1120

          .         .         .         .         .         .       g.128035
 TGTAAAGTCACCAATATTGAAGGCTTGCTACATAAGAATAACTGGAATATAGAGGACAAT       c.3420
 C  K  V  T  N  I  E  G  L  L  H  K  N  N  W  N  I  E  D  N         p.1140

          .         .         .         .         .         .       g.128095
 AATATTAAAAATGCATCCCTGGTTCAAATTGATGCCAGTAATGAACAGTCATCAACTTCG       c.3480
 N  I  K  N  A  S  L  V  Q  I  D  A  S  N  E  Q  S  S  T  S         p.1160

          .         .         .  | 18      .         .         .    g.133169
 TCTTCCATGATTATTGATGCCCAGATCTCAA | ATGCTCTTAATGCTCAGCAGTATAAAGTC    c.3540
 S  S  M  I  I  D  A  Q  I  S  N |   A  L  N  A  Q  Q  Y  K  V      p.1180

          .         .         .         .         .         .       g.133229
 CTCATTGGTAACCGGGAGTGGATGATTAGAAATGGTCTTGTCATTAATAACGATGTAAAT       c.3600
 L  I  G  N  R  E  W  M  I  R  N  G  L  V  I  N  N  D  V  N         p.1200

          .         .         .         .         .         | 19    g.134897
 GATTTCATGACTGAACATGAGAGAAAAGGTCGGACTGCTGTATTAGTAGCAGTTGATG | AT    c.3660
 D  F  M  T  E  H  E  R  K  G  R  T  A  V  L  V  A  V  D  D |       p.1220

          .         .         .         .         .         .       g.134957
 GAGCTGTGTGGCTTGATAGCCATTGCAGACACAGTGAAGCCTGAAGCAGAACTGGCTATC       c.3720
 E  L  C  G  L  I  A  I  A  D  T  V  K  P  E  A  E  L  A  I         p.1240

          .         .         .         .         .         .       g.135017
 CATATTCTGAAATCTATGGGCTTAGAAGTAGTTCTGATGACTGGAGACAACAGTAAAACA       c.3780
 H  I  L  K  S  M  G  L  E  V  V  L  M  T  G  D  N  S  K  T         p.1260

          .         .  | 20      .         .         .         .    g.136928
 GCTAGATCTATTGCTTCTCAG | GTTGGCATTACTAAGGTGTTTGCTGAAGTTCTACCTTCT    c.3840
 A  R  S  I  A  S  Q   | V  G  I  T  K  V  F  A  E  V  L  P  S      p.1280

          .         .         .         .         .         .       g.136988
 CACAAGGTTGCTAAAGTGAAGCAACTTCAAGAGGAGGGGAAACGGGTAGCAATGGTGGGA       c.3900
 H  K  V  A  K  V  K  Q  L  Q  E  E  G  K  R  V  A  M  V  G         p.1300

          .         .         .         .         .         .       g.137048
 GATGGAATCAATGACTCCCCAGCTCTGGCAATGGCTAATGTGGGAATTGCTATTGGCACA       c.3960
 D  G  I  N  D  S  P  A  L  A  M  A  N  V  G  I  A  I  G  T         p.1320

          .         .         .         .      | 21  .         .    g.137636
 GGCACAGATGTAGCCATTGAAGCAGCTGATGTGGTTTTGATAAGG | AATGATCTTCTGGAT    c.4020
 G  T  D  V  A  I  E  A  A  D  V  V  L  I  R   | N  D  L  L  D      p.1340

          .         .         .         .         .         .       g.137696
 GTAGTGGCAAGTATTGACTTATCAAGAGAGACAGTCAAGAGGATTCGGATAAATTTTGTC       c.4080
 V  V  A  S  I  D  L  S  R  E  T  V  K  R  I  R  I  N  F  V         p.1360

          .         .         .         .    | 22    .         .    g.139790
 TTTGCTCTAATTTATAATCTGGTTGGAATTCCCATAGCTGCTG | GAGTTTTTATGCCCATT    c.4140
 F  A  L  I  Y  N  L  V  G  I  P  I  A  A  G |   V  F  M  P  I      p.1380

          .         .         .         .         .         .       g.139850
 GGTTTGGTTTTGCAGCCCTGGATGGGATCTGCAGCAATGGCTGCTTCATCTGTTTCTGTA       c.4200
 G  L  V  L  Q  P  W  M  G  S  A  A  M  A  A  S  S  V  S  V         p.1400

          .         .       | 23 .         .         .         .    g.140631
 GTACTTTCTTCTCTCTTCCTTAAACT | TTACAGGAAACCAACTTACGAGAGTTATGAACTG    c.4260
 V  L  S  S  L  F  L  K  L  |  Y  R  K  P  T  Y  E  S  Y  E  L      p.1420

          .         .         .         .         .         .       g.140691
 CCTGCCCGGAGCCAGATAGGACAGAAGAGTCCTTCAGAAATCAGCGTTCATGTTGGAATA       c.4320
 P  A  R  S  Q  I  G  Q  K  S  P  S  E  I  S  V  H  V  G  I         p.1440

          .         .         .         .         .         .       g.140751
 GATGATACCTCAAGGAATTCTCCTAAACTGGGTTTGCTGGACCGGATTGTTAATTATAGC       c.4380
 D  D  T  S  R  N  S  P  K  L  G  L  L  D  R  I  V  N  Y  S         p.1460

          .         .         .         .         .         .       g.140811
 AGAGCCTCTATAAACTCACTACTGTCTGATAAACGCTCCCTAAACAGTGTTGTTACCAGT       c.4440
 R  A  S  I  N  S  L  L  S  D  K  R  S  L  N  S  V  V  T  S         p.1480

          .         .         .         .         .         .       g.140871
 GAACCTGACAAGCACTCACTCCTGGTGGGAGACTTCAGGGAAGATGATGACACTGCATTA       c.4500
 E  P  D  K  H  S  L  L  V  G  D  F  R  E  D  D  D  T  A  L         p.1500

                                                                    g.140874
 TAA                                                                c.4503
 X                                                                  p.1500

          .         .         .         .         .         .       g.140934
 aaggccatggagagtgctgccagtttaacttgtcatgcactgacacagcattcatgatgt       c.*60

          .         .         .         .         .         .       g.140994
 taccttcacttttcaaaatattgtagaaggatttttctcatgctcttatattagggattc       c.*120

          .         .         .         .         .         .       g.141054
 tatttgagttgcgtttatctgttggcaaaaatatctttttcaaggcatcagctctgaacc       c.*180

          .         .         .         .         .         .       g.141114
 tagctttatttaaactgaatttccagtatatttttgttttcactaacaacagataaggta       c.*240

          .         .         .         .         .         .       g.141174
 gagcagtgaggtttacaacaagccctacaattagagattgctgaactgctgctaaagtga       c.*300

          .         .         .         .         .         .       g.141234
 ttttttttttatttgaccaaaaaaaaaaaggcccaagaagaagaaaatgaaaaatttgaa       c.*360

          .         .         .         .         .         .       g.141294
 gatttgagagcatgaagatattcatgcttttgaactcaaaatattgaagatactctcaag       c.*420

          .         .         .         .         .         .       g.141354
 cctgtatccctgccccactggggagcaatgactttcaaagcactgtgtataaaacatcta       c.*480

          .         .         .         .         .         .       g.141414
 gttttagaagggaaacagttgaaactgtttaaaaatagatgtgccttatttattgcaggc       c.*540

          .         .         .         .         .         .       g.141474
 tttctttcccccattctccctgcatccttgtccttgcaggtgcttttttagatgctccaa       c.*600

          .         .         .         .         .         .       g.141534
 tatgtcttcttttgttattttctttcgagctaaccaagtttaggtggtttttcattgatt       c.*660

          .         .         .         .         .         .       g.141594
 aaaaataactgacaactgttctaatattttgctcctttttaaattttgtagctcaaaaga       c.*720

          .         .         .         .         .         .       g.141654
 ccttaaaggtctgtagggttccctgcctcccatctttccactgttgtaaaaagtatatca       c.*780

          .         .         .         .         .         .       g.141714
 aattattccttcaagtttcctagctctgtgctcagtttcagttcactcctgccaagttgg       c.*840

          .         .         .         .         .         .       g.141774
 actctaagttattcttcatgtagtctgctgatctcagtctggaaacttaacattatgagc       c.*900

          .         .         .         .         .         .       g.141834
 cttttctgctcaaaaaattttcaaagattaaaactattatacatatacaggtcatataaa       c.*960

          .         .         .         .         .         .       g.141894
 attacctggattcactaaatttgtttgttgttgttgttgttgttgttgttgttgttgaga       c.*1020

          .         .         .         .         .         .       g.141954
 cagagtcttgttttgcagcccaggctggagtgcagtggcaccatcttggctcactgcaac       c.*1080

          .         .         .         .         .         .       g.142014
 ctctgcctaccggattcaaggaattctccctgcctcagcctcctgagtagctaggattac       c.*1140

          .         .         .         .         .         .       g.142074
 aggtgcctgccaccacacccggctaattttcatatttttcagtagagacggggtttcgcc       c.*1200

          .         .         .         .         .         .       g.142134
 atgttggctagcctggtcttaaactcctaacctcaggtgatccacccgccttggcctccc       c.*1260

          .         .         .         .         .         .       g.142194
 aaagtgctgggattacaggtgtgagcctccatgcccagcctaaatttgtattttttgaat       c.*1320

          .         .         .         .         .         .       g.142254
 tgagtataatcactttgctagtatatataatttaatagattttatttatcttttagtgtt       c.*1380

          .         .         .         .         .         .       g.142314
 tcagataacctctcaaaaagactttaaaataatgctattacacaaagctgcatttaccaa       c.*1440

          .         .         .         .         .         .       g.142374
 aaaatacagtaaaatcataatacagaaactaaaatttccctaggttatgacgctttttag       c.*1500

          .         .         .         .         .         .       g.142434
 ctaaatatatactcttctctagtttaaaacatttgaacttgcctagttagtgtggttggc       c.*1560

          .         .         .         .         .         .       g.142494
 aaatttaggagcttgttcccattgccaaatggatttagaaattcccttgtgagtgcctgg       c.*1620

          .         .         .         .         .         .       g.142554
 tagctaatacactggtcagagatctggtacttgtaagactatttaaatttctttgttagt       c.*1680

          .         .         .         .         .         .       g.142614
 tgcaagatggatttcatatgcagaatatgtaaatgaagaggactcataagtaaattccta       c.*1740

          .         .         .         .         .         .       g.142674
 acattttgttcccattaccagaagcaaagctgctgctaacccaacatctggcacatagga       c.*1800

          .         .         .         .         .         .       g.142734
 tttgtactcggtaaatgttagttcttttctccccttgaggtcagtaataaatacaaaaaa       c.*1860

          .         .         .         .         .         .       g.142794
 atcatttttctagagcagagtcttaaaatcaggtgggggtaggggatggagttcttcctt       c.*1920

          .         .         .         .         .         .       g.142854
 tcctaccccttttctcttttatcctttcatatatacacatgcaaagtttacaaccttatt       c.*1980

          .         .         .         .         .         .       g.142914
 ccatgctgtctttcagatttagaaaagatctaatttctgtctcagctgtcttaaagagag       c.*2040

          .         .         .         .         .         .       g.142974
 aactgaagcttttgatgaaggtgctattaatctagaaaggcaaacccatttcactgaaat       c.*2100

          .         .         .         .         .         .       g.143034
 atcaatgggtttgcatatctaggccctttttttagaccaatgcctatgccatcctccatg       c.*2160

          .         .         .         .         .         .       g.143094
 ctttcagtttgagttttattatttattattttaattccagtggcccatcttataatacaa       c.*2220

          .         .         .         .         .         .       g.143154
 cttgtttcttctagaagacagagctgatagggtaaatgttgaaaaaagaagcatgcctcc       c.*2280

          .         .         .         .         .         .       g.143214
 ttctccctcccacccacctcaagcagttgaacacagccagttattcttccattattatgt       c.*2340

          .         .         .         .         .         .       g.143274
 gtaccttggagtcatcctcttggtcttgtattcatattgtgggacagtgggaatagcagc       c.*2400

          .         .         .         .         .         .       g.143334
 ttgtagtattgaaataatcaaagagataatttcagctcttacaacaagaacagaaaacat       c.*2460

          .         .         .         .         .         .       g.143394
 gctaattagaaaaagtcctgctttaagtaatatgtagccacatttgaatcctctaccaca       c.*2520

          .         .         .         .         .         .       g.143454
 agtcttttttgcaatcttgaactttcattagcttcaaagagaagctgtatttacaggaga       c.*2580

          .         .         .         .         .         .       g.143514
 aagaggtgattatggagggaatcaaaaatactgctttcagttagtagctagctttaagtc       c.*2640

          .         .         .         .         .         .       g.143574
 aggagttagtaatgagaaattttataaatgtgtatttctgtgtattcacatacatatata       c.*2700

          .         .         .         .         .         .       g.143634
 tatacacacatatatatgtacatacacatacatacatattaccatactgaagggaaatgg       c.*2760

          .         .         .         .         .         .       g.143694
 atttatatttgaatttgatatttgaatatttgaagttctctatttatatttcatttatca       c.*2820

          .         .         .         .         .         .       g.143754
 ctcttctgtattcactcagcaaccatgcccttagtctgaagataacaaggatactttaat       c.*2880

          .         .         .         .         .         .       g.143814
 atccagtgccggttcagactcacctatgtggcaccttaaacttaaatatccaaagatgcc       c.*2940

          .         .         .         .         .         .       g.143874
 ttttgaatttcaaagattaaaacacagctagagtagtagtattgtagtctcaagatgtat       c.*3000

          .         .         .         .         .         .       g.143934
 ggtgtgtcatttgtgaaaatagaaacgttatttttcctagtttagtatcaacattttaga       c.*3060

          .         .         .         .         .         .       g.143994
 atgtcaaatttgatgccttgtgaacaagtaattttatattgtgctttaattttttaaaaa       c.*3120

          .         .         .         .         .         .       g.144054
 gtattctttattcatatgtatagaatgcttaaaatagcactgtagacaagatgtttccaa       c.*3180

          .         .         .         .         .         .       g.144114
 aactttaagtgcgcatatcttttctgtatacagcttaaaatcaaaaatgtatgttaagag       c.*3240

          .         .         .         .         .         .       g.144174
 aattttttctattacttatggatcatgctttaaaatgatttttcttgatatttattttac       c.*3300

          .         .         .         .         .         .       g.144234
 tccattttgtttttttctctgggtgaggcatctggttactggttattttaaaaagaataa       c.*3360

          .         .         .         .         .         .       g.144294
 agacattcctggaatcactccttttgggtttttgtttgttttgtttcttttctacatttt       c.*3420

          .         .         .         .         .         .       g.144354
 taagtattattttacaaaatagaaaaaatatagattcatgccaaattattacctattttt       c.*3480

          .         .         .         .         .         .       g.144414
 acactaactttctgcagtccctccatctggtatgagtaaccagatagagcacaaagcatg       c.*3540

          .         .         .         .         .         .       g.144474
 agttcttgttcttcagttaaaagagcttctttcacagtgttgataacaaatgccttttgt       c.*3600

          .         .         .         .         .         .       g.144534
 agccaaaaccaggcgtctcaaccttacgtttttagttaaagaaatgtttagctaaacgtt       c.*3660

          .         .         .         .         .         .       g.144594
 gttgaacattgattgtttggtaccgaaaacagcagtggacgatgttgtgcaatatccatc       c.*3720

          .         .         .         .         .         .       g.144654
 tactgtagttaagatattcagtagtttgtttttcataagcatgtaattgatcatatttct       c.*3780

          .         .         .         .                           g.144699
 gccaaggatgtgccttcaactttataattatagtgttgtaaaata                      c.*3825

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ATPase, Cu++ transporting, alpha polypeptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 32
©2004-2011 Leiden University Medical Center