thymidine phosphorylase (TYMP) - coding DNA reference sequence

(used for mutation description)

(last modified May 25, 2011)


This file was created to facilitate the description of sequence variants in the TYMP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011860.1, covering TYMP transcript NM_001113755.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5024
                                     cgactgccgagctccgccctccag       c.-181

 .         .         .         .         .         .                g.5084
 gcggccccacccgcctgccgtcctggggcgccgccgccccgccgccggcagtggaccgct       c.-121

 .         .         .         .         .         .                g.5144
 gtgcgcgaaccctgaaccctacggtcccgacccgcgggcgaggccgggtacctgggctgg       c.-61

 .         .         .         .        | 02.         .             g.5376
 gatccggagcaagcgggcgagggcagcgccctaagcag | gcatccccgcaggcccggagcg    c.-1

          .         .         .         .         .         .       g.5436
 ATGGCAGCCTTGATGACCCCGGGAACCGGGGCCCCACCCGCGCCTGGTGACTTCTCCGGG       c.60
 M  A  A  L  M  T  P  G  T  G  A  P  P  A  P  G  D  F  S  G         p.20

          .         .         .         .         .         .       g.5496
 GAAGGGAGCCAGGGACTTCCCGACCCTTCGCCAGAGCCCAAGCAGCTCCCGGAGCTGATC       c.120
 E  G  S  Q  G  L  P  D  P  S  P  E  P  K  Q  L  P  E  L  I         p.40

          .         .         .         .         .         .       g.5556
 CGCATGAAGCGAGACGGAGGCCGCCTGAGCGAAGCGGACATCAGGGGCTTCGTGGCCGCT       c.180
 R  M  K  R  D  G  G  R  L  S  E  A  D  I  R  G  F  V  A  A         p.60

          .         .         .     | 03   .         .         .    g.5773
 GTGGTGAATGGGAGCGCGCAGGGCGCACAGATCG | GGGCCATGCTGATGGCCATCCGACTT    c.240
 V  V  N  G  S  A  Q  G  A  Q  I  G |   A  M  L  M  A  I  R  L      p.80

          .         .         .         .         .         .       g.5833
 CGGGGCATGGATCTGGAGGAGACCTCGGTGCTGACCCAGGCCCTGGCTCAGTCGGGACAG       c.300
 R  G  M  D  L  E  E  T  S  V  L  T  Q  A  L  A  Q  S  G  Q         p.100

          .         .         .         .         .         .       g.5893
 CAGCTGGAGTGGCCAGAGGCCTGGCGCCAGCAGCTTGTGGACAAGCATTCCACAGGGGGT       c.360
 Q  L  E  W  P  E  A  W  R  Q  Q  L  V  D  K  H  S  T  G  G         p.120

          .         .         .         .         .        | 04.    g.6478
 GTGGGTGACAAGGTCAGCCTGGTCCTCGCACCTGCCCTGGCGGCATGTGGCTGCAAG | GTG    c.420
 V  G  D  K  V  S  L  V  L  A  P  A  L  A  A  C  G  C  K   | V      p.140

          .         .         .         .         .         .       g.6538
 CCAATGATCAGCGGACGTGGTCTGGGGCACACAGGAGGCACCTTGGATAAGCTGGAGTCT       c.480
 P  M  I  S  G  R  G  L  G  H  T  G  G  T  L  D  K  L  E  S         p.160

          .         .         .       | 05 .         .         .    g.7392
 ATTCCTGGATTCAATGTCATCCAGAGCCCAGAGCAG | ATGCAAGTGCTGCTGGACCAGGCG    c.540
 I  P  G  F  N  V  I  Q  S  P  E  Q   | M  Q  V  L  L  D  Q  A      p.180

          .         .         .         .         .         .       g.7452
 GGCTGCTGTATCGTGGGTCAGAGTGAGCAGCTGGTTCCTGCGGACGGAATCCTATATGCA       c.600
 G  C  C  I  V  G  Q  S  E  Q  L  V  P  A  D  G  I  L  Y  A         p.200

          .         .         .         .       | 06 .         .    g.7816
 GCCAGAGATGTGACAGCCACCGTGGACAGCCTGCCACTCATCACAG | CCTCCATTCTCAGT    c.660
 A  R  D  V  T  A  T  V  D  S  L  P  L  I  T  A |   S  I  L  S      p.220

          .         .         .         .         .         .       g.7876
 AAGAAACTCGTGGAGGGGCTGTCCGCTCTGGTGGTGGACGTTAAGTTCGGAGGGGCCGCC       c.720
 K  K  L  V  E  G  L  S  A  L  V  V  D  V  K  F  G  G  A  A         p.240

          .         .         .         .      | 07  .         .    g.8362
 GTCTTCCCCAACCAGGAGCAGGCCCGGGAGCTGGCAAAGACGCTG | GTTGGCGTGGGAGCC    c.780
 V  F  P  N  Q  E  Q  A  R  E  L  A  K  T  L   | V  G  V  G  A      p.260

          .         .         .         .         .         .       g.8422
 AGCCTAGGGCTTCGGGTCGCGGCAGCGCTGACCGCCATGGACAAGCCCCTGGGTCGCTGC       c.840
 S  L  G  L  R  V  A  A  A  L  T  A  M  D  K  P  L  G  R  C         p.280

          .         .         .         .         .         .       g.8482
 GTGGGCCACGCCCTGGAGGTGGAGGAGGCGCTGCTCTGCATGGACGGCGCAGGCCCGCCA       c.900
 V  G  H  A  L  E  V  E  E  A  L  L  C  M  D  G  A  G  P  P         p.300

          .         .         | 08         .         .         .    g.8641
 GACTTAAGGGACCTGGTCACCACGCTCG | GGGGCGCCCTGCTCTGGCTCAGCGGACACGCG    c.960
 D  L  R  D  L  V  T  T  L  G |   G  A  L  L  W  L  S  G  H  A      p.320

          .         .         .         .         .         .       g.8701
 GGGACTCAGGCCCAGGGCGCTGCCCGGGTGGCCGCGGCGCTGGACGACGGCTCGGCCCTT       c.1020
 G  T  Q  A  Q  G  A  A  R  V  A  A  A  L  D  D  G  S  A  L         p.340

          .         .         .         .         .         .       g.8761
 GGCCGCTTCGAGCGGATGCTGGCGGCGCAGGGCGTGGATCCCGGTCTGGCCCGAGCCCTG       c.1080
 G  R  F  E  R  M  L  A  A  Q  G  V  D  P  G  L  A  R  A  L         p.360

          .         .         .         .         .         .       g.8821
 TGCTCGGGAAGTCCCGCAGAACGCCGGCAGCTGCTGCCTCGCGCCCGGGAGCAGGAGGAG       c.1140
 C  S  G  S  P  A  E  R  R  Q  L  L  P  R  A  R  E  Q  E  E         p.380

          .          | 09        .         .         .         .    g.8985
 CTGCTGGCGCCCGCAGATG | GCACCGTGGAGCTGGTCCGGGCGCTGCCGCTGGCGCTGGTG    c.1200
 L  L  A  P  A  D  G |   T  V  E  L  V  R  A  L  P  L  A  L  V      p.400

          .         .         .         .         .         .       g.9045
 CTGCACGAGCTCGGGGCCGGGCGCAGCCGCGCTGGGGAGCCGCTCCGCCTGGGGGTGGGC       c.1260
 L  H  E  L  G  A  G  R  S  R  A  G  E  P  L  R  L  G  V  G         p.420

          .         .         .         . | 10       .         .    g.9187
 GCAGAGCTGCTGGTCGACGTGGGTCAGAGGCTGCGCCGTG | GGACCCCCTGGCTCCGCGTG    c.1320
 A  E  L  L  V  D  V  G  Q  R  L  R  R  G |   T  P  W  L  R  V      p.440

          .         .         .         .         .         .       g.9247
 CACCGGGACGGCCCCGCGCTCAGCGGCCCGCAGAGCCGCGCCCTGCAGGAGGCGCTCGTA       c.1380
 H  R  D  G  P  A  L  S  G  P  Q  S  R  A  L  Q  E  A  L  V         p.460

          .         .         .         .         .         .       g.9307
 CTCTCCGACCGCGCGCCATTCGCCGCCCCCTCGCCCTTCGCAGAGCTCGTTCTGCCGCCG       c.1440
 L  S  D  R  A  P  F  A  A  P  S  P  F  A  E  L  V  L  P  P         p.480

                                                                    g.9316
 CAGCAATAA                                                          c.1449
 Q  Q  X                                                            p.482

          .                                                         g.9334
 agctcctttgccgcgaaa                                                 c.*18

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Thymidine phosphorylase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 31
©2004-2011 Leiden University Medical Center