solute carrier family 26, member 3 (SLC26A3) - coding DNA reference sequence

(used for mutation description)

(last modified June 29, 2011)


This file was created to facilitate the description of sequence variants in the SLC26A3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008046.1, covering SLC26A3 transcript NM_000111.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5031
                              atatggatgcacacagagcctgtagacctga       c.-181

 .         .         .         .         .         .                g.5091
 gtggatggacactgcctcttagaactagaacttagaactttatcttgaaaatgtaccact       c.-121

 .         .         .         .  | 02      .         .             g.13664
 gttgcagaagctcctcacagagtatgtgtcag | gcatttttaacctgctaaaggcaagaag    c.-61

 .         .         .         .         .         .                g.13724
 aagtgttcaccacatagttgcaaaggtcttcaacttgccacagccaacagaaaaatcaaa       c.-1

          .         .         .         .         .         .       g.13784
 ATGATTGAACCCTTTGGGAATCAGTATATTGTGGCCAGGCCAGTGTATTCTACAAATGCT       c.60
 M  I  E  P  F  G  N  Q  Y  I  V  A  R  P  V  Y  S  T  N  A         p.20

          .         .         .         .         .         .       g.13844
 TTTGAGGAAAATCATAAAAAGACAGGAAGACATCATAAGACATTTCTGGATCATCTCAAA       c.120
 F  E  E  N  H  K  K  T  G  R  H  H  K  T  F  L  D  H  L  K         p.40

          .  | 03      .         .         .         .         .    g.14401
 GTGTGTTGTAG | CTGTTCCCCACAAAAGGCCAAGAGAATTGTCCTCTCTTTGTTCCCCATA    c.180
 V  C  C  S  |  C  S  P  Q  K  A  K  R  I  V  L  S  L  F  P  I      p.60

          .         .         .         .         .         .       g.14461
 GCATCTTGGTTGCCAGCATACCGGCTTAAAGAATGGTTGCTCAGTGATATTGTTTCTGGT       c.240
 A  S  W  L  P  A  Y  R  L  K  E  W  L  L  S  D  I  V  S  G         p.80

          .         .         .  | 04      .         .         .    g.16322
 ATCAGCACAGGGATTGTGGCCGTACTACAAG | GTTTAGCATTTGCTCTGCTGGTCGACATT    c.300
 I  S  T  G  I  V  A  V  L  Q  G |   L  A  F  A  L  L  V  D  I      p.100

          .         .         .         .         .         .       g.16382
 CCCCCAGTCTATGGGTTGTATGCATCCTTTTTCCCAGCCATAATCTACCTTTTCTTCGGC       c.360
 P  P  V  Y  G  L  Y  A  S  F  F  P  A  I  I  Y  L  F  F  G         p.120

          .         .   | 05     .         .         .         .    g.17036
 ACTTCCAGACACATATCCGTGG | GTCCGTTTCCGATTCTGAGTATGATGGTGGGACTAGCA    c.420
 T  S  R  H  I  S  V  G |   P  F  P  I  L  S  M  M  V  G  L  A      p.140

          .         .         .         .         .         .       g.17096
 GTTTCAGGAGCAGTTTCAAAAGCAGTCCCAGATCGCAATGCAACTACTTTGGGATTGCCT       c.480
 V  S  G  A  V  S  K  A  V  P  D  R  N  A  T  T  L  G  L  P         p.160

          .         .         .         .         .         .       g.17156
 AACAACTCGAATAATTCTTCACTACTGGATGACGAGAGGGTGAGGGTGGCGGCGGCGGCA       c.540
 N  N  S  N  N  S  S  L  L  D  D  E  R  V  R  V  A  A  A  A         p.180

          .         .         . | 06       .         .         .    g.18575
 TCAGTCACAGTGCTTTCTGGAATCATCCAG | TTGGCTTTTGGGATTCTGCGGATTGGATTT    c.600
 S  V  T  V  L  S  G  I  I  Q   | L  A  F  G  I  L  R  I  G  F      p.200

          .         .         .         .         .         .       g.18635
 GTAGTGATATACCTGTCTGAGTCCCTCATCAGTGGCTTCACTACTGCTGCTGCTGTTCAT       c.660
 V  V  I  Y  L  S  E  S  L  I  S  G  F  T  T  A  A  A  V  H         p.220

          .         .         .         .         .         .       g.18695
 GTTTTGGTTTCCCAACTCAAATTCATTTTTCAGTTGACAGTCCCGTCACACACTGATCCA       c.720
 V  L  V  S  Q  L  K  F  I  F  Q  L  T  V  P  S  H  T  D  P         p.240

          .      | 07  .         .         .         .         .    g.20769
 GTTTCAATTTTCAAA | GTACTATACTCTGTATTCTCACAAATAGAGAAGACTAATATTGCA    c.780
 V  S  I  F  K   | V  L  Y  S  V  F  S  Q  I  E  K  T  N  I  A      p.260

          .         .         .         .         .         .       g.20829
 GACCTGGTGACAGCTCTGATTGTCCTTTTGGTTGTATCCATTGTTAAAGAAATAAATCAG       c.840
 D  L  V  T  A  L  I  V  L  L  V  V  S  I  V  K  E  I  N  Q         p.280

          .         .         .         .         | 08         .    g.21336
 CGCTTCAAAGACAAACTTCCAGTGCCCATTCCAATCGAATTCATTATG | ACCGTGATTGCA    c.900
 R  F  K  D  K  L  P  V  P  I  P  I  E  F  I  M   | T  V  I  A      p.300

          .         .         .         .         .         .       g.21396
 GCAGGTGTATCCTACGGCTGTGACTTTAAAAACAGGTTTAAAGTGGCTGTGGTTGGGGAC       c.960
 A  G  V  S  Y  G  C  D  F  K  N  R  F  K  V  A  V  V  G  D         p.320

          .  | 09      .         .         .         .         .    g.24930
 ATGAATCCTGG | ATTTCAGCCCCCTATTACACCTGACGTGGAGACTTTCCAAAACACCGTA    c.1020
 M  N  P  G  |  F  Q  P  P  I  T  P  D  V  E  T  F  Q  N  T  V      p.340

          .         .         .         .         .         .       g.24990
 GGAGATTGCTTCGGCATCGCAATGGTTGCATTTGCAGTGGCCTTTTCAGTTGCCAGCGTC       c.1080
 G  D  C  F  G  I  A  M  V  A  F  A  V  A  F  S  V  A  S  V         p.360

          .         .         .          | 10        .         .    g.25161
 TATTCCCTCAAATACGATTATCCACTTGATGGCAATCAG | GAGTTAATAGCCTTGGGACTG    c.1140
 Y  S  L  K  Y  D  Y  P  L  D  G  N  Q   | E  L  I  A  L  G  L      p.380

          .         .         .         .         .         .       g.25221
 GGTAACATAGTCTGTGGAGTATTCAGAGGATTTGCTGGGAGTACTGCCCTCTCCAGATCA       c.1200
 G  N  I  V  C  G  V  F  R  G  F  A  G  S  T  A  L  S  R  S         p.400

          .         .         .    | 11    .         .         .    g.25386
 GCAGTTCAGGAGAGCACAGGAGGCAAAACACAG | ATTGCTGGGCTTATTGGTGCCATCATC    c.1260
 A  V  Q  E  S  T  G  G  K  T  Q   | I  A  G  L  I  G  A  I  I      p.420

          .         .         .         .         .  | 12      .    g.28479
 GTGCTGATTGTCGTTCTAGCCATTGGATTTCTCCTGGCGCCTCTACAAAAG | TCCGTCCTG    c.1320
 V  L  I  V  V  L  A  I  G  F  L  L  A  P  L  Q  K   | S  V  L      p.440

          .         .         .         .         .         .       g.28539
 GCAGCTTTAGCATTGGGAAACTTAAAGGGAATGCTGATGCAGTTTGCTGAAATAGGCAGA       c.1380
 A  A  L  A  L  G  N  L  K  G  M  L  M  Q  F  A  E  I  G  R         p.460

          .         .        | 13.         .         .         .    g.29985
 TTGTGGCGAAAGGACAAATATGATTGT | TTAATTTGGATCATGACCTTCATCTTCACCATT    c.1440
 L  W  R  K  D  K  Y  D  C   | L  I  W  I  M  T  F  I  F  T  I      p.480

          .         .         .         .         .         .       g.30045
 GTCCTGGGACTCGGGTTAGGCCTGGCAGCTAGTGTGGCATTTCAACTGCTAACCATCGTG       c.1500
 V  L  G  L  G  L  G  L  A  A  S  V  A  F  Q  L  L  T  I  V         p.500

          .     | 14   .         .         .         .         .    g.31573
 TTCAGGACCCAATT | TCCAAAATGCAGCACGCTGGCTAATATTGGAAGAACCAACATCTAT    c.1560
 F  R  T  Q  F  |  P  K  C  S  T  L  A  N  I  G  R  T  N  I  Y      p.520

          .         .     | 15   .         .         .         .    g.31725
 AAGAATAAAAAAGATTATTATGAT | ATGTATGAGCCAGAAGGAGTGAAAATTTTCAGATGT    c.1620
 K  N  K  K  D  Y  Y  D   | M  Y  E  P  E  G  V  K  I  F  R  C      p.540

          .         .         .         .         .        | 16.    g.33364
 CCATCTCCTATCTACTTTGCAAACATTGGTTTCTTTAGGCGGAAACTTATCGATGCT | GTT    c.1680
 P  S  P  I  Y  F  A  N  I  G  F  F  R  R  K  L  I  D  A   | V      p.560

          .         .         .         .         .         .       g.33424
 GGCTTTAGTCCACTTCGAATTCTACGCAAGCGCAACAAAGCTTTGAGGAAAATCCGAAAA       c.1740
 G  F  S  P  L  R  I  L  R  K  R  N  K  A  L  R  K  I  R  K         p.580

          .         .         .    | 17    .         .         .    g.34107
 CTGCAGAAGCAAGGCTTGCTACAAGTGACACCA | AAAGGATTTATATGTACTGTTGACACC    c.1800
 L  Q  K  Q  G  L  L  Q  V  T  P   | K  G  F  I  C  T  V  D  T      p.600

          .         .         .         .         .         .       g.34167
 ATAAAAGATTCTGACGAAGAGCTGGACAACAATCAGATAGAAGTACTGGACCAGCCAATC       c.1860
 I  K  D  S  D  E  E  L  D  N  N  Q  I  E  V  L  D  Q  P  I         p.620

          .         .         .         .         .         .       g.34227
 AATACCACAGACCTGCCTTTCCACATTGACTGGAATGATGATCTTCCTCTCAACATTGAG       c.1920
 N  T  T  D  L  P  F  H  I  D  W  N  D  D  L  P  L  N  I  E         p.640

          .         .         .         .         .         .       g.34287
 GTCCCCAAAATCAGCCTCCACAGCCTCATTCTTGACTTTTCAGCAGTGTCCTTTCTTGAT       c.1980
 V  P  K  I  S  L  H  S  L  I  L  D  F  S  A  V  S  F  L  D         p.660

          .         .        | 18.         .         .         .    g.36158
 GTTTCTTCAGTGAGGGGCCTTAAATCG | ATTTTGCAAGAATTTATCAGGATCAAGGTAGAT    c.2040
 V  S  S  V  R  G  L  K  S   | I  L  Q  E  F  I  R  I  K  V  D      p.680

          .         .   | 19     .         .         .         .    g.40363
 GTGTATATCGTTGGAACTGATG | ATGACTTCATTGAGAAGCTTAACCGGTATGAATTTTTT    c.2100
 V  Y  I  V  G  T  D  D |   D  F  I  E  K  L  N  R  Y  E  F  F      p.700

          .         .         .         .         .         .       g.40423
 GATGGTGAAGTGAAAAGCTCAATATTTTTCTTAACAATCCATGATGCTGTTTTGCATATT       c.2160
 D  G  E  V  K  S  S  I  F  F  L  T  I  H  D  A  V  L  H  I         p.720

          .         .         .         .      | 20  .         .    g.40604
 TTGATGAAGAAAGATTACAGTACTTCAAAGTTTAATCCCAGTCAG | GAAAAAGATGGAAAA    c.2220
 L  M  K  K  D  Y  S  T  S  K  F  N  P  S  Q   | E  K  D  G  K      p.740

          .         .         .         .         .  | 21      .    g.42364
 ATTGATTTTACCATAAATACAAATGGAGGATTACGTAATCGGGTATATGAG | GTGCCAGTT    c.2280
 I  D  F  T  I  N  T  N  G  G  L  R  N  R  V  Y  E   | V  P  V      p.760

          .                                                         g.42379
 GAAACAAAATTCTAA                                                    c.2295
 E  T  K  F  X                                                      p.764

          .         .         .         .         .         .       g.42439
 tcaacatataattcagaaggatcttcatctgactatgacataaaaacaactttataccca       c.*60

          .         .         .         .         .         .       g.42499
 gaaagttattgataagttcatacattgtacgaagagtatttttgacagaatatgtttcaa       c.*120

          .         .         .         .         .         .       g.42559
 actttggaacaagatggttctagcatggcatatttttcacatatctagtatgaaattata       c.*180

          .         .         .         .         .         .       g.42619
 taagtattctaaattttatatcttgtagctttatcaaagggtgaaaattattttgttcat       c.*240

          .         .         .         .         .         .       g.42679
 acatatttttgtagcactgacagatttccatcctagtcactaccttcatgcataggttta       c.*300

          .         .         .         .         .         .       g.42739
 gcagtatagtggcgccactgttttgaatctcataatttatacaggtcatattaatatatt       c.*360

          .         .                                               g.42767
 tccattaaaaaatcagttgtacagtgga                                       c.*388

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Solute carrier family 26, member 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 31
©2004-2011 Leiden University Medical Center