sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - upstream reference sequence


                                                   g.1          g.1
                                                   c.-5341 t    c.-5341

.         .         .         .         .         .             g.61
aggataaatccagagcaacgttagttaaagttaattcagccccactgctaagataagacc    c.-5281

.         .         .         .         .         .             g.121
cttctgcagagtctacccaatatctcctgtgttttgaggtcttttcactttgactgggga    c.-5221

.         .         .         .         .         .             g.181
ggataaaatattactatccctgtgtgaggtccaagaatttttaacctgctacttaagatt    c.-5161

.         .         .         .         .         .             g.241
acagtcatgtcagtcatgtgccagataacacttcagtcaaggacagactgcatatatgat    c.-5101

.         .         .         .         .         .             g.301
ggtggtcccacagattataatactgtatttttactgtaacttttctatgtttaggtatga    c.-5041

.         .         .         .         .         .             g.361
ttagacacaaaaataccactgtgttacaattgtctcagtacagtaacatgttgtacaggt    c.-4981

.         .         .         .         .         .             g.421
ttatagcctagaagcaataggctataccataaagactaagtatgtagtagactataccat    c.-4921

.         .         .         .         .         .             g.481
ctaggtttgtgtaagtactgtctctatgatgttaaaattgcctagtgacacatttctcgg    c.-4861

.         .         .         .         .         .             g.541
tacatatctccattgttaggcaatgcatgactgtagttctttctctggcttagggtattt    c.-4801

.         .         .         .         .         .             g.601
ttgttttcacacaattgcagaatgctgtcaagcaaaaacttgaggtctctttctacagat    c.-4741

.         .         .         .         .         .             g.661
ctctggtatactctctgttcagctcccttgtcttaggtgtcctgtcccaaataaacaaat    c.-4681

.         .         .         .         .         .             g.721
tctagctccctcagcctatcaaactcttattttctggctcttcatgtttccatcttcctg    c.-4621

.         .         .         .         .         .             g.781
agctgtggtttagaaactttgtgtagtatgcagagacaatcacagcctcactttctttct    c.-4561

.         .         .         .         .         .             g.841
cttctctagggatcactgtcttatagataatgttgcccaatgactgaaaactagtgtttc    c.-4501

.         .         .         .         .         .             g.901
atatattttgtccccttatctaatggaagacttctacaagggaatgtcgataacaatagt    c.-4441

.         .         .         .         .         .             g.961
tttgatcaaaaataactccacagaaagcacattatcagcaaaaccattgttagggtaagg    c.-4381

.         .         .         .         .         .             g.1021
gacccatcagtggactatgacactggggaaaattcttcaggaataagtaatcaattaata    c.-4321

.         .         .         .         .         .             g.1081
tacttactaagcatctactacatgcaagacaaaacatttatttttcttcacatcagtttt    c.-4261

.         .         .         .         .         .             g.1141
ctggccaaaaaaatccagaccacgtcaaattagacgagcaaacactcagatgccaataca    c.-4201

.         .         .         .         .         .             g.1201
tttaggaaacctcttttcttcagttgtttcattaagcatcatttgcccatctcatcactc    c.-4141

.         .         .         .         .         .             g.1261
caatctatgtctgataatcttcattgtatattctatttctttttagttataatttgaagt    c.-4081

.         .         .         .         .         .             g.1321
tctacttttgaatcctactttttagctatgtatacacaaaacttgtaactttattcttct    c.-4021

.         .         .         .         .         .             g.1381
attttcacaacagaataattgttttttcttactttgtaatattgccgtgcagccaatatt    c.-3961

.         .         .         .         .         .             g.1441
agaaggtaaaagtatttttctaatcctatttaattagagaaaaacaaactctttcagtat    c.-3901

.         .         .         .         .         .             g.1501
tgtattaattttattgccttaatattactgtctattttttgttcttccagaaacttctac    c.-3841

.         .         .         .         .         .             g.1561
agttttgaaaattgcagtggcaattgtggaaaatacagaagtgtggatatccatttattt    c.-3781

.         .         .         .         .         .             g.1621
ctcactaagggaaataaaattcttattcctattctggtatggattgtatgatgttagtta    c.-3721

.         .         .         .         .         .             g.1681
atttccatgactcaacatttccacatttttctatctaagttacggaaggtcagttgtaaa    c.-3661

.         .         .         .         .         .             g.1741
tatgattaggaacttattggttattggctttttcaaccagacaggctttgtctggttccc    c.-3601

.         .         .         .         .         .             g.1801
ttaattcaagcctaccctttaaattttaaacgtaccatctacttatgtctacatctgacg    c.-3541

.         .         .         .         .         .             g.1861
ctgtcatttagtgtttaatgaactctcaaggctgtgcagtgtagtatttaataagaaatt    c.-3481

.         .         .         .         .         .             g.1921
tggaaagatactttttctgggtttaaaccaagataaaatttctagggctgccaaaagagc    c.-3421

.         .         .         .         .         .             g.1981
aagaaaaacacaaacagctaatgttctgtagactaggaatggcacataaaagaaatggaa    c.-3361

.         .         .         .         .         .             g.2041
aggaaataaatagttggaacatgaaagaaaattgggaaaataatgaataatatacctaat    c.-3301

.         .         .         .         .         .             g.2101
gctttgcctatgagctcacagggaaaatcctgcaagggatccctcagtcagaccaagagg    c.-3241

.         .         .         .         .         .             g.2161
attttatttttggttttatcattttccaggattttatgtttgaagatctctaacaagaac    c.-3181

.         .         .         .         .         .             g.2221
ctagatatattgagaatagtaagttcttgttaatggatgcttaaagtggaatatataata    c.-3121

.         .         .         .         .         .             g.2281
tgttatatattatatacaacatatgtattatacataacatatattataacataatatagt    c.-3061

.         .         .         .         .         .             g.2341
aatataatatataacatgttataatatataggttatatataatgtataatgcattatata    c.-3001

.         .         .         .         .         .             g.2401
ttccactctaagaatgtatctaacatatgtgttattctagatataacagcaaaggcataa    c.-2941

.         .         .         .         .         .             g.2461
tctataagagacataattgctaaggtgaactgcattaaaattaaaaacttctgctctgca    c.-2881

.         .         .         .         .         .             g.2521
aaaacggacaacaagccagtgttagataaatatttgcaaaagacacatctgacaaatgac    c.-2821

.         .         .         .         .         .             g.2581
tgttaaccaaaatatacaaataaagcttaaaactcaacaacaagaaaagaaataacccaa    c.-2761

.         .         .         .         .         .             g.2641
tgaaaaaaatgggccatataccttaacagaccaaagaagatgcacatattgcaaataagc    c.-2701

.         .         .         .         .         .             g.2701
atataaaaaggtgatccacatcatatatcacaggggaaatgcaaatcaaataacacttat    c.-2641

.         .         .         .         .         .             g.2761
ggtatcaacaatgggcatgagataccaccacatatgtattggaataaccaaaatccagaa    c.-2581

.         .         .         .         .         .             g.2821
cactgatgatatcaagttctggccaaggatgtgaggcaacaggaactctcatgtattgct    c.-2521

.         .         .         .         .         .             g.2881
ggtgggaatgcaaaatgctccagccactttgaggacagtgtagcagtttctttaaaaact    c.-2461

.         .         .         .         .         .             g.2941
aaacatactctcaccatatgatccagcaattgtgctccttgatgttcacccaaaggactt    c.-2401

.         .         .         .         .         .             g.3001
gaaaacatgtccacacagtaaccttcacaaagatgtttatagaggctttacgcataattg    c.-2341

.         .         .         .         .         .             g.3061
ctaaaacttggaagcaaacaagatgtccttcagtaggtgaatgaataaactatggtacca    c.-2281

.         .         .         .         .         .             g.3121
ccagtcaatggaatattattcagcactgtaaagaaatgagctatcaagctatgaaaagcc    c.-2221

.         .         .         .         .         .             g.3181
atggaggaaaactaaaagcatattgctaagtgaaaggagtcaatctgaaagggctatatt    c.-2161

.         .         .         .         .         .             g.3241
ctgtattattgcaactataggatatcctggagaaggcaaaactataaagacagtaaaatg    c.-2101

.         .         .         .         .         .             g.3301
atcagtacttgccaggggttgaaatgggagatgaataagtggaacacagagaattcagga    c.-2041

.         .         .         .         .         .             g.3361
gagaactgaaattactctgtaagatactgtaatggtggatacatgtcattatatatttgc    c.-1981

.         .         .         .         .         .             g.3421
ctaaccccatagaatggacaacaccatgagctaaccctaaatgtgaactacagaccttgg    c.-1921

.         .         .         .         .         .             g.3481
gagataatgaaacctcaaagtaagttcattaattttaacaaatgtttcattctggtgggg    c.-1861

.         .         .         .         .         .             g.3541
aatgttgataatgggggaggctattcttgtgtgggagtagcggttatgtgggaaatctct    c.-1801

.         .         .         .         .         .             g.3601
gtaccctcccttcagttttgctgtgaacctaaaattgctctaaaaataaaattttaaaaa    c.-1741

.         .         .         .         .         .             g.3661
taaaagaatgtggcattgcttgcatctaataaaaaagaccattattcctattgcagttga    c.-1681

.         .         .         .         .         .             g.3721
actcttcttcctatatctaccaccaatcagggaagagaaggcgatttgtccaggatatgg    c.-1621

.         .         .         .         .         .             g.3781
cactgagaattatcacaagtgagctagttcaccttcattgcacagtctcagtcactgaag    c.-1561

.         .         .         .         .         .             g.3841
tttccttccttcaatagcacatcttacaagtcaagaatgtaaggtccaaagccccaggac    c.-1501

.         .         .         .         .         .             g.3901
aaatctcagaagcaaagaaagcagcagggaaaagtagaccctgggatttgatttccttcc    c.-1441

.         .         .         .         .         .             g.3961
ggttatctctaagcatcatttccatgatagaaggtgtggaagcaaataataaaagtgccc    c.-1381

.         .         .         .         .         .             g.4021
gtcactagtgtttatcctgcaaagtggtctgcccttttgagaggcaccctgccctatggc    c.-1321

.         .         .         .         .         .             g.4081
catcctttgatttcttcccttggtggaaatttcctgtttctctttgagaaagataattca    c.-1261

.         .         .         .         .         .             g.4141
accctgtttccattgttcttcctcccaggctgctgtaggaaagcgcacgcacacactcca    c.-1201

.         .         .         .         .         .             g.4201
cacaaaatgaatttttaaaaaatttattttcacagtcgctcctaccagctctgaaattca    c.-1141

.         .         .         .         .         .             g.4261
gaacccatatgactgatggcatattcagataatcgggtcccaggtctggaaaagcagcct    c.-1081

.         .         .         .         .         .             g.4321
tttccccacgtttctttccccacctaggacctcctctgattcttcactgcatcttcgaaa    c.-1021

.         .         .         .         .         .             g.4381
gaaaatgtattatttgcttgcctggaagacgctgcaattcaattgattttatatatacat    c.-961

.         .         .         .         .         .             g.4441
atatataaagaaaacagaaaacatagcctagataccggtcttgagcgtcaccgccccact    c.-901

.         .         .         .         .         .             g.4501
cgcggttgtgagcaaagccctacggaagaaaccaattcccagcctagactcttcagagcc    c.-841

.         .         .         .         .         .             g.4561
caaggtcggggaggcgctggcctggcggtgttgtctggctccccagccactgccccagac    c.-781

.         .         .         .         .         .             g.4621
tcagggctttgccattggtccccacctcctctgctccggagtttttctccagctccccac    c.-721

.         .         .         .         .         .             g.4681
caagccacacaaagtgacttctcggaaacattagccgattctgctgagcaggaagggagg    c.-661

.         .         .         .         .         .             g.4741
aaagggatgatgggggcgggggtgagataagggaagggctcttctggctgctggacacac    c.-601

.         .         .         .         .         .             g.4801
acacacacacactcaaacacacacacgccccacccaatgggtggccgtggatggcaggtc    c.-541

.         .         .         .         .         .             g.4861
gtgcaaccccctcctccgccttctattagcgcatggtgcagaggctacagcgtcgccacc    c.-481

.         .         .         .         .         .             g.4921
accgcgcccctagctgggtccccgccctgcgccgcccgcaggagtggagagagggaggga    c.-421

.         .         .         .         .         .             g.4981
gggagggagcaaggggtggggacccgggcgcgctgggaggagtggaggaggcaaagcggc    c.-361

.         .            .         .         .         .          g.5041
gcagctgccctcggggagg \ cggggctgctacctccacgggcgcgccctggcaggaggggc c.-301


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center