sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 134 nt intron 25 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.176688
gtaaaaaaatatatatatctttagcatatagattttcaaattatttctaattcattttta  c.4470+60

         g.176695
atgcaca  c.4470+67

--------------------- middle of intron ---------------------
                                          g.176696            g.176702
                                          c.4471-67  tctttaa  c.4471-61

.         .         .         .         .         .           g.176762
tttctggataatacttgaaaagtttactctgcattcgatattattcttatttctttgcag  c.4471-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center