sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 4631 nt intron 20 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.142954
gtaggtacttttgagtacattttaaaagaggatttattcttactgtgtgttgtgaaaaaa  c.3768+60

         .         .         .         .         .         .  g.143014
ccttcaccactattgcatattatcatattttaattttgttaagcttcatatattttcagg  c.3768+120

         .         .         .         .         .         .  g.143074
ctataggtttattcttttagaaatattaacacagccagtggaaatatatctgtgaggaat  c.3768+180

         .         .         .         .         .         .  g.143134
attagaacagaaatcgttcaacaaatgtaaattatttctgtgacattgtaacatttataa  c.3768+240

         .         .         .         .         .         .  g.143194
ttgagttttttatgttttctgcaaaggagatgtgattttttaaaaaatatgatttgaatg  c.3768+300

         .         .         .         .         .         .  g.143254
tcattcttgttaagaataaaacaaaatttagaagtaggagatgataaaagggcagagaca  c.3768+360

         .         .         .         .         .         .  g.143314
cagattaaagagaggaaatgatgattattcataatgtaaaattggaagataagagaggat  c.3768+420

         .         .         .         .         .         .  g.143374
gaggggcacatcaagttggctgatatgtgagctaaaatttttctaaaaatcattatacaa  c.3768+480

         .         .         .         .         .         .  g.143434
atacaaagttaactttgtatttggggagagagaagtcatgaaattttaaaatatctatct  c.3768+540

         .         .         .         .         .         .  g.143494
cagacccaattataggaaaaaccaaaatgagacacaattgtctctatctcaaatatgcga  c.3768+600

         .         .         .         .         .         .  g.143554
cttgcccttcatctccagaatggcagtggggcagaggagtaggcattattattaatgtaa  c.3768+660

         .         .         .         .         .         .  g.143614
taattttagataataaattcaaagaactgttgaatacttggatgatggaaaatacataat  c.3768+720

         .         .         .         .         .         .  g.143674
aattctttagtttacatattattttaacgaagtagaaatatttttacaggcttctgattg  c.3768+780

         .         .         .         .         .         .  g.143734
agatagagaagaaatcttaaaatagtcggtgagatcaaggactctcaaatagaaactaac  c.3768+840

         .         .         .         .         .         .  g.143794
ggtacaatacccattattatcatttcattgaatgtactctaattattttatattttaata  c.3768+900

         .         .         .         .         .         .  g.143854
atataacttaataatatatatgacatattttgtattaattaaaatggctttcttacatta  c.3768+960

         .         .         .         .         .         .  g.143914
ttttataacctcaatctcccagtcttatttttctcagaatgatatgttctttatctttta  c.3768+1020

         .         .         .         .         .         .  g.143974
ctaattcttctagattttcagaaacctaacctttgtgtttagggaagaaacatcctataa  c.3768+1080

         .         .         .         .         .         .  g.144034
tcagtcatagtttttagagatttgttttccatatgatgcctgacataattagaggtcaac  c.3768+1140

         .         .         .         .         .         .  g.144094
acgcaaatttgtatatgccaataagtgctttaaaatttaaccaagggtttgcattatcga  c.3768+1200

         .         .         .         .         .         .  g.144154
gcttttaagaaaagttgaattcatacagcatcatatgtggattagaaaatcacaagtaag  c.3768+1260

         .         .         .         .         .         .  g.144214
catgatcatacatagtaaaatctgactgcaaaatgttaccaaattagtcatatttactca  c.3768+1320

         .         .         .         .         .         .  g.144274
aaagttcaatttctcaactgttattcaaagcttcataaacttttggcttctggccaggcg  c.3768+1380

         .         .         .         .         .         .  g.144334
cggtagctcacgcctgtaatcccagcactttgagagtccgaggcaggtggatcacctgag  c.3768+1440

         .         .         .         .         .         .  g.144394
gtcaggagtttgagaccagcctggccaacatggtgaaaccccgtctctactaaaaaatac  c.3768+1500

         .         .         .         .         .         .  g.144454
aaaaaattagccagacatggtggcaggtgcctgtaatcccagctactcaggaggctgagg  c.3768+1560

         .         .         .         .         .         .  g.144514
cagaagaatcgcttgaacccggtaggcagaggtttcagtgagtcgagatcgtgccactgc  c.3768+1620

         .         .         .         .         .         .  g.144574
actccagcttgggcgacagggtgagactccatctcaaaaaaaataataataattttcgtt  c.3768+1680

         .         .         .         .         .         .  g.144634
ttcttaatcacacaacatattaaatgttaaaaacaataacttttttctataatatgtaat  c.3768+1740

         .         .         .         .         .         .  g.144694
gtgaaaaaatttttaacatagctatatattacaccttatatgtgttatcttaggtttcct  c.3768+1800

         .         .         .         .         .         .  g.144754
ctatgagaattctaacttcggatatagtaatgatttcttgctatttttcaattaatcatt  c.3768+1860

         .         .         .         .         .         .  g.144814
catatatcaagttatctagttactgcctaaaaaatgaaaaatgataaaatgggtattttt  c.3768+1920

         .         .         .         .         .         .  g.144874
gtaatatagtagttttgaagaaaggctgccccaaataagaagaaattatagaaggaatgt  c.3768+1980

         .         .         .         .         .         .  g.144934
agattttcttttctcttaaactgtaaatatgacggggtctctctcttaaaaaattataca  c.3768+2040

         .         .         .         .         .         .  g.144994
atattttagatattttaaaatctttaaaatattatcacaaatacactcattttcatcatt  c.3768+2100

         .         .         .         .         .         .  g.145054
cagtgtaagaaatgaaggtttacaagtaaaattgaacttattttaaattaagagatatgg  c.3768+2160

         .         .         .         .         .         .  g.145114
ctgtttaataatggaaattgttttatttgaaaatttaaagtgatgattctcagtgagtat  c.3768+2220

         .         .         .         .         .         .  g.145174
aacctcctgttcaggggtatgtaatgtgcagaaatcagggagataaacaactccaatttg  c.3768+2280

         .         .         .        g.145210
aaatattatttaatattttggaaacgaacaaatata  c.3768+2316

--------------------- middle of intron ---------------------
            g.145211          .         .         .           g.145245
            c.3769-2315  atgcaaagcacagagagtaaagctccacacaatat  c.3769-2281

.         .         .         .         .         .           g.145305
tcttgctgacagagatgcaaattttgggacacagatttgggggagtggctgatttttttt  c.3769-2221

.         .         .         .         .         .           g.145365
ttttctgaaaagtatagaaacttatctacagcagttgttcttgaaggatggtctcaaaac  c.3769-2161

.         .         .         .         .         .           g.145425
tgaaaacgttggcacatgtaggtgagaactcataagagatgcaaattctgcccccaaccc  c.3769-2101

.         .         .         .         .         .           g.145485
caagacatactgaatcagaaactctggggttggatgtggcaaatcattgtaacaagccct  c.3769-2041

.         .         .         .         .         .           g.145545
acagatgattctgttgtatattcagatttcagaactacttatattatttgctactcagag  c.3769-1981

.         .         .         .         .         .           g.145605
aatggacttgtctgatttctgcaggcttctgggttatttgaaacttacttgattaaacag  c.3769-1921

.         .         .         .         .         .           g.145665
tgttcttcagtacaggcgtatatttgtatatatacgtgtgtgtttatagaaagatgtgaa  c.3769-1861

.         .         .         .         .         .           g.145725
tatatatgcatatatattctcagttacaaactataccatagtcttaataatatgcatata  c.3769-1801

.         .         .         .         .         .           g.145785
ttccgtgtcataaaactcacttaacagtggcttggagaacagacctattagtattttagg  c.3769-1741

.         .         .         .         .         .           g.145845
ggctgtatcaattataacagacatgtcttagtctaccttttattgctgtaactgaatacc  c.3769-1681

.         .         .         .         .         .           g.145905
tgagactggttaaagtattcaataaagaaatttatttcttaaagttctggaagctgggaa  c.3769-1621

.         .         .         .         .         .           g.145965
gtctaaggtgaagggtccacatctggtgggaactttcttgctggtgggcacaccagagag  c.3769-1561

.         .         .         .         .         .           g.146025
tcccaaggcagctcatggcatcacatggcgaggggtgttcactgagagccaaactgggtt  c.3769-1501

.         .         .         .         .         .           g.146085
ttataataaacccactcttgtgatatctaactcactcccatgataacccattaagccctt  c.3769-1441

.         .         .         .         .         .           g.146145
actctatattccattcatgaaggcagaaccttcatgacctcatcaccttttaaaggctct  c.3769-1381

.         .         .         .         .         .           g.146205
gcctcttaatactgttacattgggaattaagttccaacatgagtttcaaaagggacaaac  c.3769-1321

.         .         .         .         .         .           g.146265
attcaaaccacagcaaaacattaaaaaaaaaattttctgattaaagagggagcatacata  c.3769-1261

.         .         .         .         .         .           g.146325
ttttcaagtgttcttaagtggaaaataatggatgtgaatgactgggcaaatttaagagtg  c.3769-1201

.         .         .         .         .         .           g.146385
gcatgaggagtaatttattctgctaaatacgtagctttaggaatttaaaaaaaaaagcca  c.3769-1141

.         .         .         .         .         .           g.146445
tgttacatttagtgagacatctggaaatactacatgaggatgagcactttaaaacacttc  c.3769-1081

.         .         .         .         .         .           g.146505
ccgcttcatcagtcagtttacctgtctctgatggtaacagcaatgaactttttgtgaaca  c.3769-1021

.         .         .         .         .         .           g.146565
atgactttttctacgcctgaaatagataaatatataaagttggctctcatctgttcctat  c.3769-961

.         .         .         .         .         .           g.146625
tcttccctcgaaaaattgaatctctcagtcactaacttattcgtaatgaagaactgcatt  c.3769-901

.         .         .         .         .         .           g.146685
ccagacatttttcttagacatcgtctcctgctacacaggatgtgaggcaaatgaatattt  c.3769-841

.         .         .         .         .         .           g.146745
tccatggaactaattcagagagtaaacatatttatagatccagatctaaggtcatggagg  c.3769-781

.         .         .         .         .         .           g.146805
agctcattgctttgtaactaaaatgtgtattgattgtattgctgttcatgttctttctta  c.3769-721

.         .         .         .         .         .           g.146865
agataatttacgataagaactcaaatttcttttggatactggttatggtaattgtggctg  c.3769-661

.         .         .         .         .         .           g.146925
atctatctaacatgatgaagctcttattatatctatattgattgtgaagccaatgagatc  c.3769-601

.         .         .         .         .         .           g.146985
agctactctcattctctcttcagtacaattgtgatttttctcccatgaaaaactatttgg  c.3769-541

.         .         .         .         .         .           g.147045
tagatctttggtgctaatctttagaaattgtagggcagaagcaatcttgttgagaatttg  c.3769-481

.         .         .         .         .         .           g.147105
ccccaactcaaaatcatgagtcttcaaaatgttttttaataagatttatactaagacata  c.3769-421

.         .         .         .         .         .           g.147165
gatttagttgagtgaataccacacttttagggcttagcttcagaatcacacacttcattt  c.3769-361

.         .         .         .         .         .           g.147225
tgacctgagttttataattaaaatgttcaccattgttctaattaaatttttagatttaat  c.3769-301

.         .         .         .         .         .           g.147285
aaggaattacaaagcaattgattacaaaagtgtgaaaagcatatgcatgatttctattca  c.3769-241

.         .         .         .         .         .           g.147345
aatagaataaacaacttactttgcttacattatttcttcttattttggttaaccttcttt  c.3769-181

.         .         .         .         .         .           g.147405
taaatctatttccttacagaaacatccatcttaccctatttttaggcattgactacacaa  c.3769-121

.         .         .         .         .         .           g.147465
ctccgtatataccatcttattgttcctgttgagttgcttttagtgagtttcagaattgac  c.3769-61

.         .         .         .         .         .           g.147525
tttttccttttatgcttcatcattttattgacacaattaatgaaaatgttatttttatag  c.3769-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center