sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 4234 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.138546
gtaaatgatctgacacctaagtcaatatattgattaagtcaatattctttaaaatgagct  c.3594+60

         .         .         .         .         .         .  g.138606
aaaagataaaaatatcatggcaagttgttttacctagaattaatccctatgattagtgcc  c.3594+120

         .         .         .         .         .         .  g.138666
aatgacaaaattttacttgagctcagtaaatagttactgagcactcctacatgccaggca  c.3594+180

         .         .         .         .         .         .  g.138726
ttatccttgctgccctgaatgctgttgtccaaaggaccacccagatggctataatagaaa  c.3594+240

         .         .         .         .         .         .  g.138786
agagaattttactggcaatatcagtttgcaaaacagggagagagtctgtggcataaactg  c.3594+300

         .         .         .         .         .         .  g.138846
aaagcactttccctgtagaacaaagagagaaggttagaggttttattaaaatgggaaaat  c.3594+360

         .         .         .         .         .         .  g.138906
gttatatattgctctttgagaaagttcattggccctagtaaggatctggggaactggtaa  c.3594+420

         .         .         .         .         .         .  g.138966
gctccaactggcgagcaacagtcgttggcacaattagtcctagagtgtaacaggtttcct  c.3594+480

         .         .         .         .         .         .  g.139026
cagaagctatagataaaactaatttcaagttacaacaagcagcttcaacagtcagtcttg  c.3594+540

         .         .         .         .         .         .  g.139086
cagagaattataattcttggagtaatgttttgtaccctgagagcttttccccctgccttc  c.3594+600

         .         .         .         .         .         .  g.139146
ttgactcttagttgactgttagttgagtaggacaagaactacccaatttgtatgatcaac  c.3594+660

         .         .         .         .         .         .  g.139206
tttcacaatgcaaagataaataagatccaggtactgtttattcttaaggagctcagagca  c.3594+720

         .         .         .         .         .         .  g.139266
atggagaagagaagaatacaaatgagtaactgtagagcttggatgtgtttgtaagcaaag  c.3594+780

         .         .         .         .         .         .  g.139326
tgtaaatgtgacaaagttctgtagcaaggagaacaactgcttgcaatttcagaaacgtaa  c.3594+840

         .         .         .         .         .         .  g.139386
atggtgcttttcagggtctagaaagacgaacaggaattttctagttaggcaaggcaggct  c.3594+900

         .         .         .         .         .         .  g.139446
gaggggaacaagtatacaatcgtaaggaggcataaaacagcatcagatattcaggaaatt  c.3594+960

         .         .         .         .         .         .  g.139506
aaaaactgctgaactgcaagtgtggtgggaagaagaacaagtacaggtggccagagatac  c.3594+1020

         .         .         .         .         .         .  g.139566
tatgagaaagcaaggtcagcttgtgaagcatcttgtgtgttataaaaagggaaaacagat  c.3594+1080

         .         .         .         .         .         .  g.139626
ggtagttttaggataaaagtaggacaagtttctcattcttgtacacatacaagcagcttc  c.3594+1140

         .         .         .         .         .         .  g.139686
catgagagttgaaagagatctagtagaattacaagctacctgaacctttttcttaattgt  c.3594+1200

         .         .         .         .         .         .  g.139746
catttttcctgctgacgctgacagagatgagccattagaagccattaggagcccagatct  c.3594+1260

         .         .         .         .         .         .  g.139806
agctagatataccactggaagtttcattatactaaaaatagaatactcaagaactttgta  c.3594+1320

         .         .         .         .         .         .  g.139866
acttgcctcatagacagtcttcatgagtttggactttgattttactgtacttatatgcta  c.3594+1380

         .         .         .         .         .         .  g.139926
ataggttgatctgatactgtttcatggatgctggcagaagatatgaggtgcttgggtcag  c.3594+1440

         .         .         .         .         .         .  g.139986
agataaaggactttgttacttatgtgtggaaagtagcatgagtttcaacatgtttctgtt  c.3594+1500

         .         .         .         .         .         .  g.140046
ggttccccctttacccaggtctcatgggggcattatatgagcctgaatgagtgtgtacac  c.3594+1560

         .         .         .         .         .         .  g.140106
atatagtggattgatgtcacagctgaggaacactgagcttagggaatgcatccttttata  c.3594+1620

         .         .         .         .         .         .  g.140166
ccaagcaacataagcaaccctgctctttgtcccagagaccctacctcatgtctcaaggtt  c.3594+1680

         .         .         .         .         .         .  g.140226
gctcactgcaaacacaaccctgaggaatgtcctaggtaaggagcaggcagagcctggcat  c.3594+1740

         .         .         .         .         .         .  g.140286
tcttggcacactccccaacaacctgcagggacccactgtggctttcctttcctatcaagt  c.3594+1800

         .         .         .         .         .         .  g.140346
ctcaactctcagaaacagaaaatgtgatcagaaaagctctattttccttacctggagtca  c.3594+1860

         .         .         .         .         .         .  g.140406
tccaagtagaaatcatgatagtgtctaccatgcaatgtattcctagtaactaaggaggtt  c.3594+1920

         .         .         .         .         .         .  g.140466
tatcccatgctgactcacatatgtgactgagaatttcagagaggagattacaaaaaaatt  c.3594+1980

         .         .         .         .         .         .  g.140526
aaagtttggagtaattccttgttcaaaatgtctaaaacagaggaagacatttggggaggg  c.3594+2040

         .         .         .         .         .         .  g.140586
cattctcaaaagtgtattttaaataaatcatatgaggaagaaaagggaaagatatttcaa  c.3594+2100

         .         g.140603
gaagctggtgtttgtac  c.3594+2117

--------------------- middle of intron ---------------------
                              g.140604            .           g.140620
                              c.3595-2117  ttagacaggttgccaat  c.3595-2101

.         .         .         .         .         .           g.140680
taaactagattttttaaaagtatagcaaacccccatgacacgtgtttacctatgtaacaa  c.3595-2041

.         .         .         .         .         .           g.140740
accttcacatgtaccctcaaacctaaaataaaagttaaaaagaagtaatagctctcattt  c.3595-1981

.         .         .         .         .         .           g.140800
agcttatacttattgtgtttcagaatcttcttttagattttctcatttaattttcaaaca  c.3595-1921

.         .         .         .         .         .           g.140860
accctgtgagattatgatattttgcttattttaccaatgatgaagctgggtacagtttta  c.3595-1861

.         .         .         .         .         .           g.140920
aaagttgcttaatgtcccaaagctagtaaatgacagagctatcactgaattgacatctaa  c.3595-1801

.         .         .         .         .         .           g.140980
aatcaaagtcaccatatcttttcactgtgttgtggctcctcagaaagaagagtatacaca  c.3595-1741

.         .         .         .         .         .           g.141040
aaacagaaataaatgagtggtaactgaatttagtaacagtaaagcgttaagtcctaaatc  c.3595-1681

.         .         .         .         .         .           g.141100
agatagagctcacataaggtcattcttgcctccttgctcctacatccacaaaattggttc  c.3595-1621

.         .         .         .         .         .           g.141160
tggaagctagaacccctgtgggctgaattctaattcctgctctgggaccagtcagagaga  c.3595-1561

.         .         .         .         .         .           g.141220
ggttctcatcatcaagacttcctgcggctctgctctgaccctgtacaccagttctagaaa  c.3595-1501

.         .         .         .         .         .           g.141280
caggcttcgttttccttgtgactaagccccttccttgtctttgtatttcaaggactgagt  c.3595-1441

.         .         .         .         .         .           g.141340
cattgccatagtttcggtttagatggcttgcctgattcctccagaatttgggggtggagt  c.3595-1381

.         .         .         .         .         .           g.141400
ggaggggaggaaaatcctgagggctagaagcctccctctgcacttcaattccattgaatt  c.3595-1321

.         .         .         .         .         .           g.141460
tcagaacctctgccaactgctgggaccttctttttgcatcttagtaggtccattcagtct  c.3595-1261

.         .         .         .         .         .           g.141520
ttctgccccaacttgtctcttttcttcaatattgataccaacagtttcccaaaactgcta  c.3595-1201

.         .         .         .         .         .           g.141580
aggataattttagagtattgaaagcagaacgtagaataagaagaatctgaatggcacaag  c.3595-1141

.         .         .         .         .         .           g.141640
ttcatgactgtagacaggtaataaatataatattaaccacgaaggatacaggtctttgac  c.3595-1081

.         .         .         .         .         .           g.141700
tttcattttatccaacagggttaatagtgtttcgatctgaaagagaaagttctaacactt  c.3595-1021

.         .         .         .         .         .           g.141760
tagacctgttgagatcagcaatcattttcagtgtctcaatgagccttttttttttttttt  c.3595-961

.         .         .         .         .         .           g.141820
tttttgagacagagtcttgctctgttgcccaggctggagtgcagtggcgtgatcttggct  c.3595-901

.         .         .         .         .         .           g.141880
cactgcaacaatgagcccaatttttcagtcctttcaaattctttgtcaagggacatgtgg  c.3595-841

.         .         .         .         .         .           g.141940
ctgaagtctaaagtcaaagtcaccctgtcctttcactgtgttgtggctcctcagacagaa  c.3595-781

.         .         .         .         .         .           g.142000
gagcatacacaaaataggagtaaatgagtgataaccaaaattagtaacagtaaagcgtaa  c.3595-721

.         .         .         .         .         .           g.142060
gccctacattagatagagctcacctaatgttgtcacataatgttgtgtgtcacttactaa  c.3595-661

.         .         .         .         .         .           g.142120
aatttcttggaaagcataggaagcaccgcattaatggagagaatagaacagtgattttta  c.3595-601

.         .         .         .         .         .           g.142180
gagctgaagctttgaaggataatatatggatgaatagtcaaaggaaaaagcaccctctgt  c.3595-541

.         .         .         .         .         .           g.142240
gttctataggcctattaagctactgcagtcattcatttagcaaatctttcctttcctgct  c.3595-481

.         .         .         .         .         .           g.142300
gctgttattaacatggtactaggcactgggatgcacaagcatttgagagctgaaagacag  c.3595-421

.         .         .         .         .         .           g.142360
gctccacatcctactggtggggaaaaaggggagtgtaggatgtgaaaagtttataacagt  c.3595-361

.         .         .         .         .         .           g.142420
ggctggccatgggatcatgtcttaaattgctaggacttatccaattttaatggagaaaga  c.3595-301

.         .         .         .         .         .           g.142480
ggaggaatcagatggaggtggaaatgatcaggtgtcagagatcatgagtctttttgtgga  c.3595-241

.         .         .         .         .         .           g.142540
ttataagtaatttcattcttttgcactttctcttgacctctgaagaccagcagcagcact  c.3595-181

.         .         .         .         .         .           g.142600
ggtgagaaggctagaactaactgttatatgataactgtaaaccagaaaaaatgtcagctg  c.3595-121

.         .         .         .         .         .           g.142660
gcccatgtcaatattatgtttcagcagtcttagcattagaattgtatttttcctgttttt  c.3595-61

.         .         .         .         .         .           g.142720
tttaaatgaatcatgaagcttaagttgtgcatgattgaaacttgaatattatttccacag  c.3595-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center