sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 4107 nt intron 16 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.104065
gtatgtaaccagatgttcatgcattttaatttctctgtggaaattattttgtgatgatgt  c.2841+60

         .         .         .         .         .         .  g.104125
gatctattatttttataattttataattaattatatctacaattattaattgcaaaagaa  c.2841+120

         .         .         .         .         .         .  g.104185
tagtgataattttaatacaagaaagaacaggaaagagaacgaaattttgtattagttttc  c.2841+180

         .         .         .         .         .         .  g.104245
ctagccaaataacccatatttatatttttcaaaatcactgcctattcattttaaggcaaa  c.2841+240

         .         .         .         .         .         .  g.104305
ggtttctatctttttctctaattttgaaagtgatggcatatgctctcttgaagctatact  c.2841+300

         .         .         .         .         .         .  g.104365
agtaaataaaatataattaagttaataataacaaaaatgaagttaataatggaccaaggc  c.2841+360

         .         .         .         .         .         .  g.104425
aaatgaaaggactggtcccgcaccttatagccatgtgtaagactagcctctatagcaagg  c.2841+420

         .         .         .         .         .         .  g.104485
atcagcacctatgccccacagaccaaagccagtccaatgcctgttattgtgtggccctgg  c.2841+480

         .         .         .         .         .         .  g.104545
gagctaagaatgatttttacatttttaagtggttaaaataatcaaaagaagaataaatga  c.2841+540

         .         .         .         .         .         .  g.104605
cacatgcacattatatgaaatgcaaattttagtgttcataaactttattcaaacatagga  c.2841+600

         .         .         .         .         .         .  g.104665
atgtcaattcatttacgtatcttctatgactgcttttacattacagtggcagaggtgaat  c.2841+660

         .         .         .         .         .         .  g.104725
agctgccatagaaatcgtatgcccaataaagtctaaaatatttatcatttggccctttac  c.2841+720

         .         .         .         .         .         .  g.104785
gaaaaagttttccagccactggcctatagcatcgcgtggacatagcaatctgcctacttt  c.2841+780

         .         .         .         .         .         .  g.104845
ttgaattagtgttttcttggcttgtactttttttttattttttttcttccttatactgat  c.2841+840

         .         .         .         .         .         .  g.104905
tagtgaaaactttcaagcttacaagcaggagaaaattgggataaaatgctcttctatgag  c.2841+900

         .         .         .         .         .         .  g.104965
ccactcatctcaattctcaaatctgccacgttgacttgtcacagttggtcagcttgacat  c.2841+960

         .         .         .         .         .         .  g.105025
caaatctctcatcaggtatccagaaggtgggatatggtaacagccatatggtaagtgcct  c.2841+1020

         .         .         .         .         .         .  g.105085
tcacttcccactgagttgaaaaaaattactaaaatattgttgtccttgtaaccaccataa  c.2841+1080

         .         .         .         .         .         .  g.105145
aaagaggattcagaagtcaggacagaaacttacattcatccagtcacacactaaatgata  c.2841+1140

         .         .         .         .         .         .  g.105205
ctgtgccagacatacacaaaggcatttatgcagcacaaattctagatttttactgcacaa  c.2841+1200

         .         .         .         .         .         .  g.105265
aaaatatacatcctggattaccattctataattgttgatcaccctcaagttgtagtaata  c.2841+1260

         .         .         .         .         .         .  g.105325
aataagcttcctagttttatatagccttacaaattccttccaatatggaatgaaatgcac  c.2841+1320

         .         .         .         .         .         .  g.105385
attctctttgtttcttcttctctgttttgtatttataagctcctatagcaggatttgctt  c.2841+1380

         .         .         .         .         .         .  g.105445
gtgtattttttttttttttgagatggaatctcgctttgttgcccaggctggagtgcaatg  c.2841+1440

         .         .         .         .         .         .  g.105505
atgtgatctcggctcaccccaacctccacctcccaggttcaagcaattcttctgcctcag  c.2841+1500

         .         .         .         .         .         .  g.105565
cctcctgagtagctgagattacaggtgcatgctaccgtgccagctaatttttgtattttt  c.2841+1560

         .         .         .         .         .         .  g.105625
agtagagacaggttttcgtcatgttggccaggctggtctcgaactcctgacctcaggtga  c.2841+1620

         .         .         .         .         .         .  g.105685
tccagcctccgtcgcctcccaaagtgctagaattacaggcgtgagctactgcgcccagct  c.2841+1680

         .         .         .         .         .         .  g.105745
gtgcatttcttcttacaaaattttgacataaaatcgtgaaattgggaaaggtataacttg  c.2841+1740

         .         .         .         .         .         .  g.105805
tgaaaacatgccacatcaaagccaataatcacaaataatttaaatgtttattatttattc  c.2841+1800

         .         .         .         .         .         .  g.105865
aggcaaattcaaagggaaaggcattcccttggctctcaccacattttccactcaatattt  c.2841+1860

         .         .         .         .         .         .  g.105925
tttagtatcttctctgtgaaaagaaaggtatttaggtattgtttagataggaaggcattg  c.2841+1920

         .         .         .         .         .         .  g.105985
tttaggtattatttagggtggaagaccaaaaccaattacccatggtctaatccttgtttt  c.2841+1980

         .         .         .         .         .         .  g.106045
taagatgcttattagggcacagaaaagtggaacacaaaagttatcagacaaggaagaagt  c.2841+2040

         .      g.106059
gatgagttctacca  c.2841+2054

--------------------- middle of intron ---------------------
                                  g.106060        .           g.106072
                                  c.2842-2053  ataaggttaaata  c.2842-2041

.         .         .         .         .         .           g.106132
aaatgcttctgacacttaaagaaagagttctagattgagacttaagggaggtttttgaag  c.2842-1981

.         .         .         .         .         .           g.106192
tgggcctttgaacaatggataatataatatttgatcatggacactggtgtgagagttatg  c.2842-1921

.         .         .         .         .         .           g.106252
ttttcctttgaaaggcaatatagatttatagtaaaaaacagaggggatatattggtgagt  c.2842-1861

.         .         .         .         .         .           g.106312
gtttcattcgtgtagaattagtgttaactaactcatattattattctttaattattaatt  c.2842-1801

.         .         .         .         .         .           g.106372
cttggcaaagaaagtatacagaagaaaattcataaagttgataaccaactcttgactaat  c.2842-1741

.         .         .         .         .         .           g.106432
ggaggaactaccaatatcatagaattaaaatttaaggaaaaaaatatattcctgatatag  c.2842-1681

.         .         .         .         .         .           g.106492
ccttccacattagagttatatgctaaactggcttctctttttttatatttctctaattta  c.2842-1621

.         .         .         .         .         .           g.106552
ttcttttgatcattttattgccagttaattgaaatggttaaggaccataggtttaggaaa  c.2842-1561

.         .         .         .         .         .           g.106612
acatttggaaaaataagttttagtcagctcgggtctatatcaggaaacttgcgaagacca  c.2842-1501

.         .         .         .         .         .           g.106672
ttaatcaaaatgagactttgaatcaagtatacattttattaatatttcttctcttgttta  c.2842-1441

.         .         .         .         .         .           g.106732
acatgataatacaaagatgatacaaatggactttattttgatttgtgatacccactaggt  c.2842-1381

.         .         .         .         .         .           g.106792
tatagaaatattagagacttatgatttttgaaggaaagaaagttgtcacagcagctgttc  c.2842-1321

.         .         .         .         .         .           g.106852
tcaacgaagtgagaaccgcatgagccactgcaccctgttaaaatggtttaacgcttgaac  c.2842-1261

.         .         .         .         .         .           g.106912
agattaaggagactaaagcagtaaaatggaccctcagatcttcaccaatattcctattaa  c.2842-1201

.         .         .         .         .         .           g.106972
aacaaatatacacaaacatgtatttcatagtgaaatatactttttcattgacaactatta  c.2842-1141

.         .         .         .         .         .           g.107032
aaccatttcagggatttttagcaattatcaaaattgttcactatgattcccagacctccg  c.2842-1081

.         .         .         .         .         .           g.107092
acctccagaattttctcctaaatcagacttattgagacacacaattttagcctgctgtct  c.2842-1021

.         .         .         .         .         .           g.107152
ttacttacatctcagagaaattgttttaggtatgaccaaaatgagggatgagtaccttct  c.2842-961

.         .         .         .         .         .           g.107212
cttcagttaggtcttacttcgatttttaaaacatgaggtagatgatttgggccatgaaaa  c.2842-901

.         .         .         .         .         .           g.107272
gacttacatcaaatgccaattcaatttccttttttgtttcctggataaaacaatgtttaa  c.2842-841

.         .         .         .         .         .           g.107332
atataatttacaatttacatgtttcctgccctctgtgaacattttttttttttacaatgt  c.2842-781

.         .         .         .         .         .           g.107392
ggagttgacctgcacttctacttcagtgagaaaaaaaaataattaactcagaaataaaac  c.2842-721

.         .         .         .         .         .           g.107452
tttgcttcaagagaatagaaattgtcctgaccttttttgtaatctcttctagggcaaaca  c.2842-661

.         .         .         .         .         .           g.107512
taataggcaatgaagccagccaatcataatgccattattgcatgtgaatcaggttcaagg  c.2842-601

.         .         .         .         .         .           g.107572
ggcaggtccttttctgtgctttaaaagtcacattaagcagtattctagcacgcttcttgg  c.2842-541

.         .         .         .         .         .           g.107632
acagaatattttattacaggaactttgtaagtattatgtgttccatttgttagaacaagt  c.2842-481

.         .         .         .         .         .           g.107692
gacatttatcttctggtaaagtgaacaaagatctttagcacaatagaaaatagtcacaat  c.2842-421

.         .         .         .         .         .           g.107752
tgttttgttctacctgtttctcacaggtaataaagagtaatgatagatgaatgctaggag  c.2842-361

.         .         .         .         .         .           g.107812
agttttttgggttcataaaagagaacttgattaaggcactactgctacagaaatgaactt  c.2842-301

.         .         .         .         .         .           g.107872
agaaatgatgtaatgataatggtgagggatcattctctctgctccccatggtaattcttc  c.2842-241

.         .         .         .         .         .           g.107932
ctgggtatggctgaccctctgctgctgagtctgcaggggctagtctagggatacagtgat  c.2842-181

.         .         .         .         .         .           g.107992
gaggagtctaccctcgcctctgtctctctcatgtggtcttatccgtgtgtgaaaaggtgc  c.2842-121

.         .         .         .         .         .           g.108052
agaaatcttcgttgctggtttgtattgtggcctatattcggaaaagtgtacttattttat  c.2842-61

.         .         .         .         .         .           g.108112
tttattttttatatttcctgtctccctatttctctaccccctctccccaccctgatatag  c.2842-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center