sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 2043 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.100691
gtaagtctcttattgtgtgttatgtactcatagtttctctttttagttgtcatcattgtc  c.2310+60

         .         .         .         .         .         .  g.100751
atttcatattttttatgtcagatgaatctgcagcctcagaattatgcatatccagaactt  c.2310+120

         .         .         .         .         .         .  g.100811
tccatatgaatggatgtgtagagtcaagtttctggttatgtcttttaaaataattgtgca  c.2310+180

         .         .         .         .         .         .  g.100871
gtactgttgaggtctacaaataacaatactatttctataaaaggttaccatcttgggagt  c.2310+240

         .         .         .         .         .         .  g.100931
tgataatgattttttctgccagcatatttcttgggagcaacacttaacatttttggttct  c.2310+300

         .         .         .         .         .         .  g.100991
ttctcacaccttcctaattacattgctgctttcttgtaagtacacacctcacatattttc  c.2310+360

         .         .         .         .         .         .  g.101051
agaaaacctatggatgtattgctttgacataatagtagtgaagtgtttgggtcctcagag  c.2310+420

         .         .         .         .         .         .  g.101111
tcccaaagtcctgggtttgaatgctgattctgcattatatgagtgatatgcccttggaca  c.2310+480

         .         .         .         .         .         .  g.101171
aatattttaactctgtagtatttaattttatcatttataaaataatacttcattataaaa  c.2310+540

         .         .         .         .         .         .  g.101231
taattatttataatataattgtaactgtatttcatttatcatattcttgggaggattaaa  c.2310+600

         .         .         .         .         .         .  g.101291
tgctttctgcttattagcctggcatatagtaaatacacaataaattaaagctatcatcat  c.2310+660

         .         .         .         .         .         .  g.101351
catcaacatcattgtcatcaaaacttcaaagacttaatgaaacaagctttaaaaacaact  c.2310+720

         .         .         .         .         .         .  g.101411
attttgagaaaccaaaatggttgaactggacatagaagactcaaggataggcaagaaggt  c.2310+780

         .         .         .         .         .         .  g.101471
gatcaacagacttctggaagatataagatccaattagtaaaattgatgccagagtgatct  c.2310+840

         .         .         .         .         .         .  g.101531
ctaaaatgtacagtgctggtcacactaactcagggtaaacaaaatgccagtttttgacta  c.2310+900

         .         .         .         .         .         .  g.101591
tggatgtgaggcaggcaccagttcatttttagggccagagaatctcagcttatgactctt  c.2310+960

         .         .         .         .         .         .  g.101651
cataaaccatgaataactttgggtatctttgtcaatgtctatataagataattttgcttt  c.2310+1020

    g.101653
tg  c.2310+1022

--------------------- middle of intron ---------------------
                                              g.101654        g.101654
                                              c.2311-1021  c  c.2311-1021

.         .         .         .         .         .           g.101714
tgtggtcccaaacaaattgacatttgaagaccagaagttcttttctgagtctgtcttttc  c.2311-961

.         .         .         .         .         .           g.101774
ttctaaattgtctacaaatattcccaatgtttttccccatgtgctcgctgagttagcatt  c.2311-901

.         .         .         .         .         .           g.101834
cttcttcccttctatttatctttggaaaaaggcaggaatatctagtttctaattgttggt  c.2311-841

.         .         .         .         .         .           g.101894
ggagatccggatcttgcaaataagtaccttctcactgagacgactgcatccctgtgaact  c.2311-781

.         .         .         .         .         .           g.101954
cagaaaggatttacctggtcacagctattaccacaacctcaagtccagctgctccctgcc  c.2311-721

.         .         .         .         .         .           g.102014
aatcttcttgatcctgcattatttgaaaattgactcctgcagttatagacctaaacattt  c.2311-661

.         .         .         .         .         .           g.102074
cccttagaatcttctttggtcagattccttgagtcaaagtgtacccaaaggattcatttc  c.2311-601

.         .         .         .         .         .           g.102134
ggtgttgcctttttaagtgagtcctttgataccagtatcatgaattaatgatattttgca  c.2311-541

.         .         .         .         .         .           g.102194
atgcacttttgtgtcaaagctttagaagtattactttagctgccacattgtcaattaaat  c.2311-481

.         .         .         .         .         .           g.102254
acttttttctcttctgctgataaatctttaaagagtgagtcaacatgttctttattactc  c.2311-421

.         .         .         .         .         .           g.102314
taacagtagtcagatcagaaaaaaaaagactggctcaaaatttcagtatcaacttatgtt  c.2311-361

.         .         .         .         .         .           g.102374
ttctttttatcttcttccagaacaactttttgacccacataaattctttgaaaatagtga  c.2311-301

.         .         .         .         .         .           g.102434
ctgtgtcaattaccaaatgttttactcttctgaaattttaatatgctattctaaaatgct  c.2311-241

.         .         .         .         .         .           g.102494
gtctaaaaatgatgagcactgacaggacagttagagcttttcaaccttttgatgctgata  c.2311-181

.         .         .         .         .         .           g.102554
tgggagccagggaagagcaatacctaatttacaggactaagttagataagaatatccatt  c.2311-121

.         .         .         .         .         .           g.102614
tataaagtatttagcaaactgtctggaacacagtaaatgctaagcaaacagtgattatta  c.2311-61

.         .         .         .         .         .           g.102674
tcattgtgttgatttcctgttttctaatattaacagaaaaacattatttttctcacttag  c.2311-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center