sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 2677 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.96562
gtgataatagataaggcaacttctgatgacagcgtaaggacgttttacatagctcaggca  c.1941+60

         .         .         .         .         .         .  g.96622
tggctgggcccttgttcctgcatcagtcagtctctctgctgaagggccttctctggtctt  c.1941+120

         .         .         .         .         .         .  g.96682
gtgaatggctctgcattttgcaatactttttctataggaacacacctttgattcattagc  c.1941+180

         .         .         .         .         .         .  g.96742
ctaatcctcattctatgtgttgtaggcatctaactcaaagataaaatcccatttttgtaa  c.1941+240

         .         .         .         .         .         .  g.96802
aaaggtacttgtctattaattttataattgaagattataaataatctctttagagaacaa  c.1941+300

         .         .         .         .         .         .  g.96862
tttatgacggatacatatatagatagatatcagtacagaaaatgcaaggataatgctgat  c.1941+360

         .         .         .         .         .         .  g.96922
attagttaataatagatcccatttctatgaagaaatttggattacttgccagctactgct  c.1941+420

         .         .         .         .         .         .  g.96982
atctttttcaggtcacagcttaatatgtacctattccaaggaatcttatttgagttgtta  c.1941+480

         .         .         .         .         .         .  g.97042
ataacagcaaacacatatttagtatttatgacaaccccatgagatgatacattattatct  c.1941+540

         .         .         .         .         .         .  g.97102
ctgttttacaaatgggaaaattgaggcatggggaaatgaagcaacttgccccaatttact  c.1941+600

         .         .         .         .         .         .  g.97162
cagctaataaatggtagctcctaagttgaaacggaggctgtctgtttcagatcttgtgct  c.1941+660

         .         .         .         .         .         .  g.97222
cttaaccactcactctgctatctctccaatgtgcagtaggcttcttatcttgaaaaaatt  c.1941+720

         .         .         .         .         .         .  g.97282
tagaatggctatgtattaggtcctccatataaatgaaacataactgttttcatttttaaa  c.1941+780

         .         .         .         .         .         .  g.97342
aaatatttcatctggagtctatgaatcaaaacaaaatatctgaaatgcaagcattgacac  c.1941+840

         .         .         .         .         .         .  g.97402
aaacaaacataaaagcaaaacaatcattttacagcagttccaaaggtctacgagtcacta  c.1941+900

         .         .         .         .         .         .  g.97462
agtggttagagaaaggtgtctgattaggcttgaaagtgagatctttctcattcctggagt  c.1941+960

         .         .         .         .         .         .  g.97522
ttccaggatatctctttagcccactcactatgctatgctgcattaccaatatcagcaagg  c.1941+1020

         .         .         .         .         .         .  g.97582
gctttgactaacccaataagcttcaaacatatgctacatgcttatatatttatatttgca  c.1941+1080

         .         .         .         .         .         .  g.97642
gacaatgtagtatttcaagtgagagtaaagttccatcaaatccatggccacacatatatt  c.1941+1140

         .         .         .         .         .         .  g.97702
tcaatttgaataaatgcatgtgcttttaggtaacatgtgacctctatgtgtgcatgatac  c.1941+1200

         .         .         .         .         .         .  g.97762
agcttaagcccttctgcaaggtatttttcattattgaatgagcatgttaaatttctgtgg  c.1941+1260

         .         .         .         .         .         .  g.97822
aatcaaactttgcttgcattttgttttgcaattatgtgtgtaatatgtaaaatactatat  c.1941+1320

         .           g.97841
aatttatatcagattagga  c.1941+1339

--------------------- middle of intron ---------------------
                             g.97842              .           g.97859
                             c.1942-1338  gattatttcatattttta  c.1942-1321

.         .         .         .         .         .           g.97919
atgaagtttcttcatttaagagttttttcaccatagaaaaatcagtatcacaataaatcc  c.1942-1261

.         .         .         .         .         .           g.97979
taaagtgaaaactacaaaactagaggaattagtggatacttataagatacaatggaaata  c.1942-1201

.         .         .         .         .         .           g.98039
cagtaaacataaaattgtggcacaatatatggtttatatgaaaacactgcataactaata  c.1942-1141

.         .         .         .         .         .           g.98099
acgtcatctctatacctgaaacatgtctacatggaaaataatttgtttaatctgacaaat  c.1942-1081

.         .         .         .         .         .           g.98159
tcttgtttgacagactatagcacagaaaacctggttttcgagacttttcaaaaagttgac  c.1942-1021

.         .         .         .         .         .           g.98219
tttttacagagatctctcaaatgggtgtgtctgttcacatacacatagatgcataataca  c.1942-961

.         .         .         .         .         .           g.98279
cccatgcacatatctatgcctgtatgtctgtgttttgatacacatacatgcatgactata  c.1942-901

.         .         .         .         .         .           g.98339
cctatacaactatacaactttacaaatctagaaatatatatttaaaatatataccacata  c.1942-841

.         .         .         .         .         .           g.98399
ccacacacaagcagacaaacatgatagatctagagttgtatagttgtttgtgtatatatg  c.1942-781

.         .         .         .         .         .           g.98459
tgtgtgtgagtgtgtgtgtgtatttctggcctgcatggaaccaacatagtgttttaaatt  c.1942-721

.         .         .         .         .         .           g.98519
tgaattagtttccaagttttaaaaataagacattttctcacaaaaataaatacacttgtt  c.1942-661

.         .         .         .         .         .           g.98579
atgcatgagttcatgtttttgcatggcaacaatttctagagctgaagagaggtcacctct  c.1942-601

.         .         .         .         .         .           g.98639
ttcagatgtagcttgcattctccatttcactaattgttcctttcaaactgagtcatttat  c.1942-541

.         .         .         .         .         .           g.98699
catcatatgctctgctcagttcatgaggtcttccttggcagtaagagacaaccattacag  c.1942-481

.         .         .         .         .         .           g.98759
gagcttcattaatgttgttccctcaataaaaagtaattccagaaatttatcagagaatac  c.1942-421

.         .         .         .         .         .           g.98819
tgagattctacccctttagatacacagcactacagcactttcactgttttcatgtaggac  c.1942-361

.         .         .         .         .         .           g.98879
tgtcacatgacaaactatctgaataaattgaacactcagaaaggcagagaggtgatgata  c.1942-301

.         .         .         .         .         .           g.98939
gtgatgatataacaaaaaagcagctagctttattttttatctcataaatattaattcctt  c.1942-241

.         .         .         .         .         .           g.98999
taatcctcacaagaatatgaagcaagcactatgattatccccattttaccaatataaaac  c.1942-181

.         .         .         .         .         .           g.99059
tgagacagttaagtagctctcctatgatatacagccagtaagtagcagagccataatttg  c.1942-121

.         .         .         .         .         .           g.99119
aacccagcaatctaggctctacttttaattactcactacagctatataagcaagatttta  c.1942-61

.         .         .         .         .         .           g.99179
tcttatacctacaatttattaggattctgttcttaagacattaattgattttttttttag  c.1942-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center