sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 1511 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.94712
gtaccacccaaattgctaaatgtgtatcacccgaggcagaatgctagagaaaaatgtctt  c.1602+60

         .         .         .         .         .         .  g.94772
attttagggtaagagaactcgggagaggatagtgagtgatttcattggtatgattttagg  c.1602+120

         .         .         .         .         .         .  g.94832
taaaaacctagtatcgctaggcatttatggaaagatgtacacaggtttccatttgggttc  c.1602+180

         .         .         .         .         .         .  g.94892
aatcatttttgaaagaccttatagtttcagaattgtcaatatattctctaataaactaat  c.1602+240

         .         .         .         .         .         .  g.94952
tttcagaagcaaaatgttcctgagaaccattgtagaaataaagagaccattcacactata  c.1602+300

         .         .         .         .         .         .  g.95012
gaataacttttatatttgtatttagtctgtgttttgtaatgcttcattggttaaaaacta  c.1602+360

         .         .         .         .         .         .  g.95072
atcttagactagtttctcttctttcttaaacagtataggtaatagtatcactcacccatt  c.1602+420

         .         .         .         .         .         .  g.95132
tggaactttggagaagcctttgatatcctccacccccaaccacatcaactactaatatgt  c.1602+480

         .         .         .         .         .         .  g.95192
agtgccatagtctgttaattctgtttatgtggaagttctctttccctttctcttttcact  c.1602+540

         .         .         .         .         .         .  g.95252
gaaaccttcatctctcaggcctccctgcttataattctgcacaaatccccaagatgaacc  c.1602+600

         .         .         .         .         .         .  g.95312
attgcttctgttttccttaggtcttccctgttttccatcacacaaccccacaaatcactt  c.1602+660

         .         .         .         .         .         .  g.95372
ttctaaactaaaaatctagttaaaaatctacaagattctcctgatatacacagtaaaaaa  c.1602+720

         .         .         .        g.95408
agatagagtccctgccttcaaaatttcacttgaacc  c.1602+756

--------------------- middle of intron ---------------------
             g.95409          .         .         .           g.95443
             c.1603-755  taggtgatgatacagaacttggacacatatatcaa  c.1603-721

.         .         .         .         .         .           g.95503
taaaaataaatatgacaggagcagtccaagctggttttgaggcaaagaccttaccatact  c.1603-661

.         .         .         .         .         .           g.95563
ttttccattgttcacaatagttgccactttgttctttacatagtaagcactaatgtctat  c.1603-601

.         .         .         .         .         .           g.95623
tgaactagatccttccaaaggatttacaccctggacatgagtcatataagcatgaattga  c.1603-541

.         .         .         .         .         .           g.95683
atttttcctcctctttggtattgggcaacttctttttaaatatttaatgactttataaat  c.1603-481

.         .         .         .         .         .           g.95743
taactggtgctaaaagctctctttaaatacactttaactgagctcttagtatgtaaggtg  c.1603-421

.         .         .         .         .         .           g.95803
gattttcaatgcaaagaaccatacagcatgatttccaatttttttgtgaagcctggggat  c.1603-361

.         .         .         .         .         .           g.95863
tgatatataaaaagttgaatgaccagtagcaatactaagttctttttttaagttataagt  c.1603-301

.         .         .         .         .         .           g.95923
tctgtgcagcaaaatgaatggcattaaaagaatggagcagtaactctaggccagaatatt  c.1603-241

.         .         .         .         .         .           g.95983
agagagctgtatagcaacaaataatttacctggtcctgaaaggatgaattctacaaattg  c.1603-181

.         .         .         .         .         .           g.96043
tttcatcccttaagtggaagaagttttcttctcactgaattgcttcgtttttaagtatgt  c.1603-121

.         .         .         .         .         .           g.96103
ttcttttaagtcagtacagagccacctgccctcaggccagtgggttcagtggtatttata  c.1603-61

.         .         .         .         .         .           g.96163
tgaagtgtacttctatcagtaggtgcttcagcaaccacgttttttttaatttttctgcag  c.1603-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center