sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 4587 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.87817
gtgagtaccaagagaaacatgcattgtatttttgaatggcatatgtacctggtgtatgtt  c.1107+60

         .         .         .         .         .         .  g.87877
aagagcctgtattaggaggttttttatttatttgagaatggaggaaactctattatctta  c.1107+120

         .         .         .         .         .         .  g.87937
ttaccaaaattataagtgttttactcccatcactaataatatgggtagttctcgaatcat  c.1107+180

         .         .         .         .         .         .  g.87997
aaataattttcttatcttttctgggcatatttaatctctagatctctcgccttcctgagt  c.1107+240

         .         .         .         .         .         .  g.88057
atatcatcccatggggtcctagttaagtaccaggacatactgtaatgttttctcaagctg  c.1107+300

         .         .         .         .         .         .  g.88117
ctcctgcacatggactgttttccatgcgtgcttgggatggcctgaagagaagaggctctc  c.1107+360

         .         .         .         .         .         .  g.88177
tgatgttcacctgctcaccatgttttatttttgaactcctatttaaagttaaagatgcaa  c.1107+420

         .         .         .         .         .         .  g.88237
ttcatttctctaagtttttctctcccaaatcaattgctcccaactgtagacttccatgat  c.1107+480

         .         .         .         .         .         .  g.88297
tttttgtattttcttccatttatatcattgatctcttgtattgcaagtggtaattcatgt  c.1107+540

         .         .         .         .         .         .  g.88357
ggctatttcctctaacttgaatgtgaacctcttggggctgtggtctccatttacttgtat  c.1107+600

         .         .         .         .         .         .  g.88417
agtctcagcagccaagccaaaaggaaggagaccaaaatgattattctatagtacacataa  c.1107+660

         .         .         .         .         .         .  g.88477
caatgattcacttttctcagaatagctgcagatctgtttttttttcttttttggcctatt  c.1107+720

         .         .         .         .         .         .  g.88537
ttatatttactttatttccgagaatattataaatgaattcggaaattatgtaagatgcac  c.1107+780

         .         .         .         .         .         .  g.88597
tttacagcaaaaatgggaatgcaaatattttttaaatatgcaagaagtggtcacctttac  c.1107+840

         .         .         .         .         .         .  g.88657
tcaaaattaaagaaacacaaataaaaaaattaaaataatttttcatcagaggtaagactt  c.1107+900

         .         .         .         .         .         .  g.88717
atttttcatttaatatcagttgatactatcctaaattcactttaaaatgctttgtatgat  c.1107+960

         .         .         .         .         .         .  g.88777
aaaagtatattacattatacaattattaatagaaatgttaattatcttataaatttgttt  c.1107+1020

         .         .         .         .         .         .  g.88837
aagttacttgtagattcttaatattagacctttgtcagatgggtagattgccaaattttt  c.1107+1080

         .         .         .         .         .         .  g.88897
ctcccattctatagtttgcctgttcactctgatgttagtttcttttgctgtgcagaagct  c.1107+1140

         .         .         .         .         .         .  g.88957
ctttagtttagttatatcccatttgtcaattttggctttggttgcaattgcttttggtat  c.1107+1200

         .         .         .         .         .         .  g.89017
ttttgtcatgaagtctttgcccatgcctatttcctgaatggtgttgcctaggttttcttc  c.1107+1260

         .         .         .         .         .         .  g.89077
tagggttttcatggtttggggttttacattaagtctttaatccatcttgagttaattttt  c.1107+1320

         .         .         .         .         .         .  g.89137
gtataaggtgtaaggaaggagcccagtttcagttttctgcatatggctagccagcttccc  c.1107+1380

         .         .         .         .         .         .  g.89197
cagcaccatttattatatagggaatcctttccacattgcttgtttttgtcaggtttgtcg  c.1107+1440

         .         .         .         .         .         .  g.89257
aagatcagatgcttgtagaagtgtggtgttatttctgaggtctctattctattccattgg  c.1107+1500

         .         .         .         .         .         .  g.89317
cctatatgtctgtttgggtaccactaccatgctgttttggttactgtaacctcatagtat  c.1107+1560

         .         .         .         .         .         .  g.89377
agtttgaagtcaggtaggctgatgcctccagctttgttctttttgcttagaattgtcttt  c.1107+1620

         .         .         .         .         .         .  g.89437
gctatatgtgctctttcctggtttcatatgaaatttaaagtagttttctaattctgtgaa  c.1107+1680

         .         .         .         .         .         .  g.89497
gatgtcaatggtaatttgatgggactagcattgaatctataaattactttcggcagtatg  c.1107+1740

         .         .         .         .         .         .  g.89557
gccatttacatgacattgattcttcctatccatgagtatggaatgtttttccatttgttt  c.1107+1800

         .         .         .         .         .         .  g.89617
gtgtcctctcttgtttccttgagtagtggcttgtagttcttgaagaggtctttcatatcc  c.1107+1860

         .         .         .         .         .         .  g.89677
tttgtaagctgtattcctaggtattttattctctttatagcaattgcaaatgggagttta  c.1107+1920

         .         .         .         .         .         .  g.89737
ttcatgatttggctctctgcttgtctattgttggtgtataggaatgcctgtgatttttgc  c.1107+1980

         .         .         .         .         .         .  g.89797
acattgattttgtatcctgataccttgctgaagttgcttatcagtttaaagagttttggg  c.1107+2040

         .         .         .         .         .         .  g.89857
gctgagatgatcgggttttctaaatatagaatcatgtcatttgcagagacaatttgactt  c.1107+2100

         .         .         .         .         .         .  g.89917
ccggtcttcctatttgaataccctttatttctttctcttgtctgattgccctggccagaa  c.1107+2160

         .         .         .         .         .         .  g.89977
attccaacactatattgaatagcagtggtgagagagggcatccttgtcttgtgccagttt  c.1107+2220

         .         .         .         .         .         .  g.90037
ttaaagggaatgcttccagctttttcccattcagtatgatattggctatggagttttcat  c.1107+2280

         .      g.90051
aaatagctcttatt  c.1107+2294

--------------------- middle of intron ---------------------
                                  g.90052         .           g.90064
                                  c.1108-2293  attttgagatatg  c.1108-2281

.         .         .         .         .         .           g.90124
ttccatcaatacctagtttattgatagtttttaacatgaatggatgttgcattttattga  c.1108-2221

.         .         .         .         .         .           g.90184
agaccttctctgcatctattgagataatcatgtggtttttgtcattggttctgtttatgt  c.1108-2161

.         .         .         .         .         .           g.90244
gatggattacatttattgatttgcatatattgaaccagccttgcatcccatcaaaaagtg  c.1108-2101

.         .         .         .         .         .           g.90304
ggcaaaggatatgaacagagacttctcaaaagaagacatttatgcggccaaaaaacatga  c.1108-2041

.         .         .         .         .         .           g.90364
aaaaaagctcaacatcagtgatcattaagaaacgcaaatcaaaaccacaatgagatacca  c.1108-1981

.         .         .         .         .         .           g.90424
tctcaagtcagtcagaatggtgattattaaaaagttgagaaacaatagattctggtgagg  c.1108-1921

.         .         .         .         .         .           g.90484
ctatgaagaaatagtagcacttttacactgttggtgggagtgtaaattagttcaacaatt  c.1108-1861

.         .         .         .         .         .           g.90544
ttgaagacagtgaggcaattccttaaggacctagaaccagaaataccatttgacctagca  c.1108-1801

.         .         .         .         .         .           g.90604
atcccattactgggtatataccgaaacgaatataaatcattctactacaaagacacatgc  c.1108-1741

.         .         .         .         .         .           g.90664
acacatatgtttattgcagtactatttacaatagcaaagagatggaatcaactcaaatgc  c.1108-1681

.         .         .         .         .         .           g.90724
ccatcaatgttaaattgtataaagaaaatgtggtacatatacaccatggaatactatgca  c.1108-1621

.         .         .         .         .         .           g.90784
gccattaaaaaagaatgagatcatgtcctttacagggacatggatgaagctggaagccat  c.1108-1561

.         .         .         .         .         .           g.90844
catcctcagcaaactaatacaggaagagaaaaccaaacactgcatgttctcactcataag  c.1108-1501

.         .         .         .         .         .           g.90904
tgggagttgaacaatttgaacacatggacacagggaggggaacaacacacaccggggcct  c.1108-1441

.         .         .         .         .         .           g.90964
gttggggggtgggaggcaaggggagggagaacgttaggacaactacctaatgcatgcagg  c.1108-1381

.         .         .         .         .         .           g.91024
tcttaaaacctagataatgggttgataggtggagcaaaccaccatagcacatgtatacct  c.1108-1321

.         .         .         .         .         .           g.91084
gtgtaaccaacctgcatgttcttcacatgtatcccataacttaaacatatgaaaaaaagc  c.1108-1261

.         .         .         .         .         .           g.91144
tcatcatcactggccattagagaaatgcaattcaaaaccacaatgagataccatctcatg  c.1108-1201

.         .         .         .         .         .           g.91204
ccagttagaatggtgataattaaaaagtcagaaaataacagatgctggagaaaatgtgga  c.1108-1141

.         .         .         .         .         .           g.91264
gaaataggaatgcttttaaactgttggtaggagtgtaaattagttcaaccagtgtggaag  c.1108-1081

.         .         .         .         .         .           g.91324
acagtgacccagcaatcccattactgggtatatacccaaaagattacatatcattctatg  c.1108-1021

.         .         .         .         .         .           g.91384
gtaaagacacatgcacacatatgtttattgtggcactattcacaatagcaaagactggga  c.1108-961

.         .         .         .         .         .           g.91444
accaacccaaatgcccatcaatgatagactggataaagaaaatgtggcacatatacacca  c.1108-901

.         .         .         .         .         .           g.91504
tggaatactatgcagccataaaaaagaataagttcatgtcctttgcagggacatggatga  c.1108-841

.         .         .         .         .         .           g.91564
agctagaaaccatcattctcagcaaactaaaacaggaacagaaaaccaaacaacgcatgt  c.1108-781

.         .         .         .         .         .           g.91624
tctcactcatgagtgagaggtgggcaatgagaacacatgggcaatgagaagatcatcaca  c.1108-721

.         .         .         .         .         .           g.91684
cactggggcctgtcggtggtggggggcaaagggaggaatagcattaggagacatacctaa  c.1108-661

.         .         .         .         .         .           g.91744
tgtaggtaacaggttgatgggtgcagcaaaccaccatggcacgtgtctacccatgtaaca  c.1108-601

.         .         .         .         .         .           g.91804
aacctgcacgttatgccaaaaaaaagaaaaaaagaaaaaaaaatctctgtaccttcagtt  c.1108-541

.         .         .         .         .         .           g.91864
taattttcctctaatcctaaaactattttgaaaaaaaattctattttaaaaagcaaagaa  c.1108-481

.         .         .         .         .         .           g.91924
agcgaaaaaaaaagttaattgaaaatacctatgagatgaataaagtaattaaataagacc  c.1108-421

.         .         .         .         .         .           g.91984
atctgcctagtgttaacattcaatgatattattaatatttgatgataaagaaagaaaaga  c.1108-361

.         .         .         .         .         .           g.92044
tagaattttaacagtaaaagggactatggatatcacctgttcctaaaatttgaaagtgag  c.1108-301

.         .         .         .         .         .           g.92104
caaaggatttaattttatgagtaattttcagactgtaggaaaaaatgcatgatttttata  c.1108-241

.         .         .         .         .         .           g.92164
ctactacacttaataatcaagaatcttacatgactttagtacaagcatattacattgcta  c.1108-181

.         .         .         .         .         .           g.92224
tattcttcgtactgaaaatgtgtttaatatttgttttccatgaagatataacttttctct  c.1108-121

.         .         .         .         .         .           g.92284
ttatatttttgataacatgagattataccaaactgtcagatttgctcatgcctgtcaaat  c.1108-61

.         .         .         .         .         .           g.92344
tgaaataatttactaaaaaaactttttattgttcaaatgacaatttccatttttccctag  c.1108-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center