sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 1226 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.86449
gtatgtaatatttgttttctttttagtctaaaggctgaaagagaaggaaaagaatgttca  c.965+60

         .         .         .         .         .         .  g.86509
gtcagtttgcaaattagtctttgattctatattgctttttatatatttcatggtattatt  c.965+120

         .         .         .         .         .         .  g.86569
tgactcattctgtcccacagcaaatccagtctttaaaatgttcacagttaatgcatactc  c.965+180

         .         .         .         .         .         .  g.86629
ttgaaagcaagactttgagacagtgctcgaattaacacaagacagaagtcatataaatct  c.965+240

         .         .         .         .         .         .  g.86689
taagaaggtagaaaatgttacttctagaaaactccaccaaaagttggttggataatttca  c.965+300

         .         .         .         .         .         .  g.86749
ggtcttctttctggaaaacgaagagtcacaaagtctatttttctttctactcccaagttc  c.965+360

         .         .         .         .         .         .  g.86809
cactcattctccaattaaatgtgactcataggtgactgaatgtcatgttttggccactct  c.965+420

         .         .         .         .         .         .  g.86869
aagcaaagggattccttggacttgggtacacatattttaagaatattgtatatataagaa  c.965+480

         .         .         .         .         .         .  g.86929
tattgtatatattcaactgtccatcttgctgcttctctcttacaccaacttcattttgta  c.965+540

         .         .         .         .         .         .  g.86989
gcatcagctgcataagctcttgcttttccccctatgcagacatctattcatcaggctctg  c.965+600

         .     g.87002
tgtacactggcaa  c.965+613

--------------------- middle of intron ---------------------
                                    g.87003       .           g.87015
                                    c.966-613  cataggaataaac  c.966-601

.         .         .         .         .         .           g.87075
tggataaggttgctgttcccagaagaatctcagaatattgtatttatttaatggcatcag  c.966-541

.         .         .         .         .         .           g.87135
gaaaaaccagtccaccaattttagaaagaaaaaagtcttaaagctgcacatttttatgaa  c.966-481

.         .         .         .         .         .           g.87195
cttagacaattactatattttgactattattgactctaatctattccaagaattatacag  c.966-421

.         .         .         .         .         .           g.87255
acagaaagagctttggtaacagcctacatatcaatatttactgaaccaagaactatcaca  c.966-361

.         .         .         .         .         .           g.87315
aaacgtctgttgaaaatttccatgttttaatgatgatgatgctaatggcagctatgattt  c.966-301

.         .         .         .         .         .           g.87375
attaaacactttctatgtgcaggatgtaagctaagtaatttgtacacattatcttattta  c.966-241

.         .         .         .         .         .           g.87435
aacttattacaagtcttattttcttgaggtagatgttattatcctattttcacagacaga  c.966-181

.         .         .         .         .         .           g.87495
cttatgccttgaagaatttggtaaagtcactaagtagtcagtagccaaatcatgtattct  c.966-121

.         .         .         .         .         .           g.87555
taatccttattcaatattgtccccctatagaagaaaccttgagtttgtaacttttcagta  c.966-61

.         .         .         .         .         .           g.87615
aggctatttagcttgtgtcctgaagacactctcacctataatgttctttctcgtgtgtag  c.966-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center