sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 935 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.76810
gtaagaagtaattggtgtgaagcattaggccactcataactccaactatttgggagttgt  c.688+60

         .         .         .         .         .         .  g.76870
tctttgttcgtttgtgtgtgtgtcgtcactgtgtgtataaactcccctattacagatatg  c.688+120

         .         .         .         .         .         .  g.76930
tgacagagtttgtggacctgggcaatgtctcagcattgagaacattcagagttctccgag  c.688+180

         .         .         .         .         .         .  g.76990
cattgaaaacaatttcagtcattccaggtgagagtggggttaaacaccagggctgacttt  c.688+240

         .         .         .         .         .         .  g.77050
gatcttttgaaagaaagacataaaaaaaacctttctttatgcaattttaattaaatttga  c.688+300

         .         .         .         .         .         .  g.77110
tttcttctgttttccacaatcattatcaaaagtcaacctttgagtttaatcaattgcatg  c.688+360

         .         .         .         .         .         .  g.77170
ggtctttaggatgaggatgactacttggctcacatctcaacttgaaatcttccctcctgt  c.688+420

         .         .         .         .          g.77218
ctgagggtttgtttttccatttgcttatacaggaaggaaaatttcaat  c.688+468

--------------------- middle of intron ---------------------
  g.77219           .         .         .         .           g.77265
  c.689-467  ccattttaattgattttaaaatacttaggaaagagatcataaatatc  c.689-421

.         .         .         .         .         .           g.77325
agcatggggatattgcatgacattgttttttattttttctcagcaaaccatttctttatt  c.689-361

.         .         .         .         .         .           g.77385
gaaaattattacaaggtgtcactatatgctgtaatttgttttggtgccatttatagagaa  c.689-301

.         .         .         .         .         .           g.77445
gtggtttgtttgacaaacattagaacttacaaaaattatttttaaagtggtttgaatagc  c.689-241

.         .         .         .         .         .           g.77505
caaattgttcattttgacaacctaggtattctttgagaatatgttcctatttttaaccat  c.689-181

.         .         .         .         .         .           g.77565
ttgctgtaatatataaaaacaaagtatatataaaatagcaaacccagaaggctttttttg  c.689-121

.         .         .         .         .         .           g.77625
aattaggttacttaaggtcattgatttgatataatgcatgactttctaggaaagcttgtg  c.689-61

.         .         .         .         .         .           g.77685
ttttttgtttcgattcagaggctttatgtcattacaaacacttttttctcccattttcag  c.689-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center