sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 589 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.74538
gtaagtgggtataagtacattttaatatagttttggtattatcatttcatcctttccttt  c.467+60

         .         .         .         .         .         .  g.74598
tcctgccaggaagttactgcatttatgaagatggggaatctttaccttcccatgttatat  c.467+120

         .         .         .         .         .         .  g.74658
gcttgcttttcttttgttctttacctcctctatgatattaacctgctagattagaaaaat  c.467+180

         .         .         .         .         .         .  g.74718
tagatgctacagtgttttctcaaagaatgaacttgtcagatgctccatcctgttcttaga  c.467+240

         .         .         .         .         .       g.74773
catgttacacatattttattcttgggtgtatgttttataattatatgggtgtatt  c.467+295

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.74827
      tttaaatgattgggtgaatttttgatagaagcaatgtaggaaatttttaggcag  c.468-241

.         .         .         .         .         .           g.74887
atctgagacctatattcttagttatttcaagtacctctgctttctgggagtgtttctgat  c.468-181

.         .         .         .         .         .           g.74947
attgacattttaatattttctggatagacctattgtagtttaatagggtgtgtccataac  c.468-121

.         .         .         .         .         .           g.75007
ccaacagccatcctccaatatatgtcttccagtggttaattagagaaaataagttataaa  c.468-61

.         .         .         .         .         .           g.75067
gatttacatggtggttgtattcttttcacatctagtatcccaatggaatcttgtgtttag  c.468-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center