sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - 4424 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.69549
gtgagtttattttgacttcagtggtcagtttctgttggcttccttctgtataaaaattat  c.258+60

         .         .         .         .         .         .  g.69609
tttaaattgagattagtgaaatttagtgaataaccatatcatgaccagaatgttaaatta  c.258+120

         .         .         .         .         .         .  g.69669
aatatatatatatatatatatatatatatatatatatatatatatataggatattcagaa  c.258+180

         .         .         .         .         .         .  g.69729
tctgtactttttcaaatttttcattgaaattggctctggcattggcatactacttttaat  c.258+240

         .         .         .         .         .         .  g.69789
ttttttttttaattatactttaagttttagggtacatgtgcacattgtgcaggttagtta  c.258+300

         .         .         .         .         .         .  g.69849
catatgtatacatgtgccatgctggtgcgctgcacccactaactggtcatctagcattag  c.258+360

         .         .         .         .         .         .  g.69909
gtatatctcccaatgctatccctcccccctccccccaccccaccacagtccctagagtgt  c.258+420

         .         .         .         .         .         .  g.69969
gatattccccttcctgtgtccatgtgatttcattgttcaattcccacctatgagtgagaa  c.258+480

         .         .         .         .         .         .  g.70029
tatgcggtgtttggttttttattcttgtgatagtttactgagaatgatgatttccaattg  c.258+540

         .         .         .         .         .         .  g.70089
catccatgtccctacaaaggacgtgaactcatcattttttatggctgcatagtattccat  c.258+600

         .         .         .         .         .         .  g.70149
ggtgtatatgagccacattttcttaatccagtctatcattgttggacatttgggttggtt  c.258+660

         .         .         .         .         .         .  g.70209
ccaagtgtttgctattgtgaataatgccacaataaacatatgtgtgcatgtgtctttata  c.258+720

         .         .         .         .         .         .  g.70269
gcagcatgatttatagtcctttgggtatatacccagtaatgggatggctgggtcaaatgg  c.258+780

         .         .         .         .         .         .  g.70329
tatttctagttctagatccctgaggaatcgccacactgacttccacaatggttgaactag  c.258+840

         .         .         .         .         .         .  g.70389
tttaccaccaacagtgtaaaagtgttcctatttctccacatcctctccagcacctgttgt  c.258+900

         .         .         .         .         .         .  g.70449
ttcctgactttttaatgattgccattctaactggtgtgagatggtatctcattgtggttt  c.258+960

         .         .         .         .         .         .  g.70509
tgatttgcatttctctgatggccagtgatgatgagcattttttcatgtgttttttggctg  c.258+1020

         .         .         .         .         .         .  g.70569
cataaatgtcttcttttgagaagtgtctgttcatgtcctttgcccactttttgatggggt  c.258+1080

         .         .         .         .         .         .  g.70629
tgtttgtttttttcttgtaaatttgtttgagttcattgtagattctggatattagccttt  c.258+1140

         .         .         .         .         .         .  g.70689
tgtcagatgagtaggttgcgaaaattgtctcccattttgtaggttgcatgttcactctga  c.258+1200

         .         .         .         .         .         .  g.70749
tggtagtttattttgctgtgcagaagctctttagtttaattagatcccatttgtcaattt  c.258+1260

         .         .         .         .         .         .  g.70809
tgtcttttgttgccattgcttttggtgttttagacatgaagtccttgcccatgcctatgt  c.258+1320

         .         .         .         .         .         .  g.70869
cctgaatggtaatgcctgggttttcttctagggtttttatggttttaggtctaatgttta  c.258+1380

         .         .         .         .         .         .  g.70929
agtctttaatccatcttgaattgatttttgtataaggtgtaaggaagggatccagtttca  c.258+1440

         .         .         .         .         .         .  g.70989
gctttctacatatggctagccagttttcccagcaccatttgttaaatagggaatcctttc  c.258+1500

         .         .         .         .         .         .  g.71049
cccattgcttgtttttctcaggtttgtcaaagatcagatagttgtagatatgtggcgtta  c.258+1560

         .         .         .         .         .         .  g.71109
tttctgagggctctgttctgttccattgatctatatctctgttttggtaccagtaccatg  c.258+1620

         .         .         .         .         .         .  g.71169
ctgtttgggttactgtagccttgtagtgtagtttgaagtcaggtagcgtgatgcctccag  c.258+1680

         .         .         .         .         .         .  g.71229
ctttgttcttttggcttaggattgacttggcgatgcgggctcttttttggttccatatga  c.258+1740

         .         .         .         .         .         .  g.71289
actttaaagtagttttttccagttctgtgaagaaagtcattggtagcttgatggggatgg  c.258+1800

         .         .         .         .         .         .  g.71349
cattgaatctgtaaattaccttgggcagtatggccattttcacgatattgattcttccta  c.258+1860

         .         .         .         .         .         .  g.71409
cacatgagcatggaatgttcttccatttgtttgtatcctcttttatttccttgagcagtg  c.258+1920

         .         .         .         .         .         .  g.71469
gtttgtagttctcctcgaagaggtccttcacatcccttgtaagttggattcctaggtatt  c.258+1980

         .         .         .         .         .         .  g.71529
ttattctctttgaagcaattgtgaaatttagtataatgtttagtataacatagtatacat  c.258+2040

         .         .         .         .         .         .  g.71589
tgtttagtataattgtttagcataacatttttggacatgacacagtgatctgccaaattt  c.258+2100

         .         .         .         .         .         .  g.71649
tataatcatacctattttttcctgctaataattaactctcatgtgtatgcagacccaaaa  c.258+2160

         .         .         .         .         .    g.71701
atcacttaaaagtttttaatgagaatgaaaattgctaatttcaattttaaaa  c.258+2212

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.71753
        taccaacaattctttttattaaaatttcaagtataaggtaacttgatcttgc  c.259-2161

.         .         .         .         .         .           g.71813
caatactatgtagtatgttgtgatttttcatgttagctcagatgacctccggtttataaa  c.259-2101

.         .         .         .         .         .           g.71873
gtctccctgataattttgacagtcatgtgaccctgttccctcttcactctcattcttccc  c.259-2041

.         .         .         .         .         .           g.71933
cctttatatttttctgtatgatatctgtcacatcttgccttatattagttactttcttct  c.259-1981

.         .         .         .         .         .           g.71993
tttcatttttctaggaagttccttgaatacaaaactcatgccttatttttgttcaaactc  c.259-1921

.         .         .         .         .         .           g.72053
cttttcattacctgttatgatatagtttctgactatacatgtattagtcttttttttttt  c.259-1861

.         .         .         .         .         .           g.72113
tttttttttgagacagagtctccctctgttgcccaggctggagtgccgtggcgcgatttt  c.259-1801

.         .         .         .         .         .           g.72173
ggctcactgcaagctccgcctcccgggttcacgccattctcccacctcagcctccagggt  c.259-1741

.         .         .         .         .         .           g.72233
agctgggactacaggtacccgccaccacacctggctaattttgtttttgtatttttagta  c.259-1681

.         .         .         .         .         .           g.72293
gagacggggattcaccgtgttagccaggatggtctcgatctcctgacgttgtgttctgcc  c.259-1621

.         .         .         .         .         .           g.72353
caccttggcctcccaaagtgctgggaacacaggcgtgagccaccacgcccggccgtatta  c.259-1561

.         .         .         .         .         .           g.72413
gtccatttttacactgctataaagaactacctgagactgggtaatttataaagaaaagag  c.259-1501

.         .         .         .         .         .           g.72473
atttaatttactcactgttctgaatggcaggggaggcctcagaaaacttacaatcatggt  c.259-1441

.         .         .         .         .         .           g.72533
cgaaggcaaaggggaagcaaggcacatcttaacatggtgcaggagagggagaaagaggag  c.259-1381

.         .         .         .         .         .           g.72593
ggaaatgccgcacttttaaacccatcagatctcatgagaactcactcactcactatcatg  c.259-1321

.         .         .         .         .         .           g.72653
agaacagcactggggaaaccgctcccatgatccaatcacttaccaccaggtccctcccct  c.259-1261

.         .         .         .         .         .           g.72713
gagacgtggggattacaattcaaaatgagatttgggcggggacacagagccaaaccatgt  c.259-1201

.         .         .         .         .         .           g.72773
caatacaattgcagaaagaatggatgaataattttttaaaaatacagtctactgagattt  c.259-1141

.         .         .         .         .         .           g.72833
aagacaaaaaggattgtacttgaggactaggtattaattttaaaataattttccatgtaa  c.259-1081

.         .         .         .         .         .           g.72893
aagtgaattttacattaaattgtatttagatagaactgatacagtgaaagggagcaggaa  c.259-1021

.         .         .         .         .         .           g.72953
aataaaaggacacctgaaaacaatagactctgatttgttttcttgagggaacgctgccgc  c.259-961

.         .         .         .         .         .           g.73013
atacaaataaaaagcctgactcacagacttacctcctgaatacggtgagaaatgcttatt  c.259-901

.         .         .         .         .         .           g.73073
gccagaaacccactgataaccctatataaaatttagaaagtcagtgtctttcagctaaca  c.259-841

.         .         .         .         .         .           g.73133
caagtcatcttcctgccaaccggagaaaaataaggctgggatttgaactttgtctttctg  c.259-781

.         .         .         .         .         .           g.73193
atttctaagccaatgctttaggttgctttaatattttgttgttactgctggttgttttta  c.259-721

.         .         .         .         .         .           g.73253
tttcttaactgaatactaaagctatggaaaaggacacttatggaatggctacaataacat  c.259-661

.         .         .         .         .         .           g.73313
ttcaagaatgtttgcttctattcatatcgttttttaaattaccgtggttagtaagtgagg  c.259-601

.         .         .         .         .         .           g.73373
aatcctcttaatttaagtcccttttaaaagctaatattagtattataactaaaataaaga  c.259-541

.         .         .         .         .         .           g.73433
aattgaactcagtgattggaaggattcttccaactctgacgttccttcaacttaggaaaa  c.259-481

.         .         .         .         .         .           g.73493
tattttttgaaataactcatattttggaacatgtgctgctaaccataacaattgccagca  c.259-421

.         .         .         .         .         .           g.73553
agtattaaaattctcaaggttttatgataaaaatattagagatagctagtttctatttgg  c.259-361

.         .         .         .         .         .           g.73613
ctttcttaaaatgcagtgtaatggaagggaaagaagttgtactttaaaataacttaacca  c.259-301

.         .         .         .         .         .           g.73673
cagttattgttactggtgaaagaaaatgaaaaatatgaaatacagtattttgaaagctct  c.259-241

.         .         .         .         .         .           g.73733
aagcaatacatgctaacaaatagctcaatttttaaagttactatgaagaagtggacttgg  c.259-181

.         .         .         .         .         .           g.73793
agttcattggccaaggtgacattgatagatgcgttgatgacattggaaccacattgctgg  c.259-121

.         .         .         .         .         .           g.73853
agtctgatggcagtgtttcttcaatataacactgccatgtagaaaggtaaactgctgata  c.259-61

.         .         .         .         .         .           g.73913
ttgatgtgaaaaattgatattttggattctcaatttcatcctttctttttcctcctgcag  c.259-1


Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center