sodium channel, voltage-gated, type IX, alpha subunit (SCN9A) - coding DNA reference sequence

(used for mutation description)

(last modified November 1, 2010)


This file was created to facilitate the description of sequence variants in the SCN9A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012798.1, covering SCN9A transcript NM_002977.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5041
                    cggggctgctacctccacgggcgcgccctggcaggaggggc       c.-301

 .         .         .         .         .         .                g.5101
 gcagtctgcttgcaggcggtcgccagcgctccagcggcggctgtcggctttccaattccg       c.-241

 .         .         .         .         .         .                g.5161
 ccagctcggctgaggctgggctagcctgggtgccagtggctgctagcggcaggcgtcccc       c.-181

 .         .         .         .         .         .                g.5221
 tgagcaacaggagcccagagaaaaagaagcagccctgagagagcgccggggaaggagagg       c.-121

 .         .         .         .         .         .                g.5281
 cccgcgccctctcctggagccagattctgcaggtgcactgggtggggatgatcggcgggc       c.-61

 .          | 02        .         .         .         .             g.69231
 taggttgcaa | gcctcttatgtgaggagctgaagaggaattaaaatatacaggatgaaaag    c.-1

          .         .         .         .         .         .       g.69291
 ATGGCAATGTTGCCTCCCCCAGGACCTCAGAGCTTTGTCCATTTCACAAAACAGTCTCTT       c.60
 M  A  M  L  P  P  P  G  P  Q  S  F  V  H  F  T  K  Q  S  L         p.20

          .         .         .         .         .         .       g.69351
 GCCCTCATTGAACAACGCATTGCTGAAAGAAAATCAAAGGAACCCAAAGAAGAAAAGAAA       c.120
 A  L  I  E  Q  R  I  A  E  R  K  S  K  E  P  K  E  E  K  K         p.40

          .         .         .         .         .         .       g.69411
 GATGATGATGAAGAAGCCCCAAAGCCAAGCAGTGACTTGGAAGCTGGCAAACAGCTGCCC       c.180
 D  D  D  E  E  A  P  K  P  S  S  D  L  E  A  G  K  Q  L  P         p.60

          .         .         .         .         .         .       g.69471
 TTCATCTATGGGGACATTCCTCCCGGCATGGTGTCAGAGCCCCTGGAGGACTTGGACCCC       c.240
 F  I  Y  G  D  I  P  P  G  M  V  S  E  P  L  E  D  L  D  P         p.80

          .         | 03         .         .         .         .    g.73955
 TACTATGCAGACAAAAAG | ACTTTCATAGTATTGAACAAAGGGAAAACAATCTTCCGTTTC    c.300
 Y  Y  A  D  K  K   | T  F  I  V  L  N  K  G  K  T  I  F  R  F      p.100

          .         .         .         .         .         .       g.74015
 AATGCCACACCTGCTTTATATATGCTTTCTCCTTTCAGTCCTCTAAGAAGAATATCTATT       c.360
 N  A  T  P  A  L  Y  M  L  S  P  F  S  P  L  R  R  I  S  I         p.120

          .        | 04.         .         .         .         .    g.74431
 AAGATTTTAGTACACTC | CTTATTCAGCATGCTCATCATGTGCACTATTCTGACAAACTGC    c.420
 K  I  L  V  H  S  |  L  F  S  M  L  I  M  C  T  I  L  T  N  C      p.140

          .         .         .         .        | 05.         .    g.75080
 ATATTTATGACCATGAATAACCCACCGGACTGGACCAAAAATGTCGA | GTACACTTTTACT    c.480
 I  F  M  T  M  N  N  P  P  D  W  T  K  N  V  E  |  Y  T  F  T      p.160

          .         .         .         .         .         .       g.75140
 GGAATATATACTTTTGAATCACTTGTAAAAATCCTTGCAAGAGGCTTCTGTGTAGGAGAA       c.540
 G  I  Y  T  F  E  S  L  V  K  I  L  A  R  G  F  C  V  G  E         p.180

          .         .         .         .         .       | 06 .    g.76662
 TTCACTTTTCTTCGTGACCCGTGGAACTGGCTGGATTTTGTCGTCATTGTTTTTGC | GTAT    c.600
 F  T  F  L  R  D  P  W  N  W  L  D  F  V  V  I  V  F  A  |  Y      p.200

          .         .         .         .         .         .       g.76722
 TTAACAGAATTTGTAAACCTAGGCAATGTTTCAGCTCTTCGAACTTTCAGAGTATTGAGA       c.660
 L  T  E  F  V  N  L  G  N  V  S  A  L  R  T  F  R  V  L  R         p.220

          .         .         | 07         .         .         .    g.77717
 GCTTTGAAAACTATTTCTGTAATCCCAG | GCCTGAAGACAATTGTAGGGGCTTTGATCCAG    c.720
 A  L  K  T  I  S  V  I  P  G |   L  K  T  I  V  G  A  L  I  Q      p.240

          .         .         .         .         .         .       g.77777
 TCAGTGAAGAAGCTTTCTGATGTCATGATCCTGACTGTGTTCTGTCTGAGTGTGTTTGCA       c.780
 S  V  K  K  L  S  D  V  M  I  L  T  V  F  C  L  S  V  F  A         p.260

          .         .         .         .         .         .       g.77837
 CTAATTGGACTACAGCTGTTCATGGGAAACCTGAAGCATAAATGTTTTCGAAATTCACTT       c.840
 L  I  G  L  Q  L  F  M  G  N  L  K  H  K  C  F  R  N  S  L         p.280

          .         .         .         .         .         .       g.77897
 GAAAATAATGAAACATTAGAAAGCATAATGAATACCCTAGAGAGTGAAGAAGACTTTAGA       c.900
 E  N  N  E  T  L  E  S  I  M  N  T  L  E  S  E  E  D  F  R         p.300

   | 08      .         .         .         .         .         .    g.86384
 A | AATATTTTTATTACTTGGAAGGATCCAAAGATGCTCTCCTTTGTGGTTTCAGCACAGAT    c.960
 K |   Y  F  Y  Y  L  E  G  S  K  D  A  L  L  C  G  F  S  T  D      p.320

       | 09  .         .         .         .         .         .    g.87670
 TCAGG | TCAGTGTCCAGAGGGGTACACCTGTGTGAAAATTGGCAGAAACCCTGATTATGGC    c.1020
 S  G  |  Q  C  P  E  G  Y  T  C  V  K  I  G  R  N  P  D  Y  G      p.340

          .         .         .         .         .         .       g.87730
 TACACGAGCTTTGACACTTTCAGCTGGGCCTTCTTAGCCTTGTTTAGGCTAATGACCCAA       c.1080
 Y  T  S  F  D  T  F  S  W  A  F  L  A  L  F  R  L  M  T  Q         p.360

          .         .        | 10.         .         .         .    g.92377
 GATTACTGGGAAAACCTTTACCAACAG | ACGCTGCGTGCTGCTGGCAAAACCTACATGATC    c.1140
 D  Y  W  E  N  L  Y  Q  Q   | T  L  R  A  A  G  K  T  Y  M  I      p.380

          .         .         .         .         .         .       g.92437
 TTCTTTGTCGTAGTGATTTTCCTGGGCTCCTTTTATCTAATAAACTTGATCCTGGCTGTG       c.1200
 F  F  V  V  V  I  F  L  G  S  F  Y  L  I  N  L  I  L  A  V         p.400

          .         .         .         .         .         .       g.92497
 GTTGCCATGGCATATGAAGAACAGAACCAGGCAAACATTGAAGAAGCTAAACAGAAAGAA       c.1260
 V  A  M  A  Y  E  E  Q  N  Q  A  N  I  E  E  A  K  Q  K  E         p.420

          .         .         .         .         .     | 11   .    g.94370
 TTAGAATTTCAACAGATGTTAGACCGTCTTAAAAAAGAGCAAGAAGAAGCTGAG | GCAATT    c.1320
 L  E  F  Q  Q  M  L  D  R  L  K  K  E  Q  E  E  A  E   | A  I      p.440

          .         .         .         .         .         .       g.94430
 GCAGCGGCAGCGGCTGAATATACAAGTATTAGGAGAAGCAGAATTATGGGCCTCTCAGAG       c.1380
 A  A  A  A  A  E  Y  T  S  I  R  R  S  R  I  M  G  L  S  E         p.460

          .         .         .         .         .         .       g.94490
 AGTTCTTCTGAAACATCCAAACTGAGCTCTAAAAGTGCTAAAGAAAGAAGAAACAGAAGA       c.1440
 S  S  S  E  T  S  K  L  S  S  K  S  A  K  E  R  R  N  R  R         p.480

          .         .         .         .         .         .       g.94550
 AAGAAAAAGAATCAAAAGAAGCTCTCCAGTGGAGAGGAAAAGGGAGATGCTGAGAAATTG       c.1500
 K  K  K  N  Q  K  K  L  S  S  G  E  E  K  G  D  A  E  K  L         p.500

          .         .         .         .         .         .       g.94610
 TCGAAATCAGAATCAGAGGACAGCATCAGAAGAAAAAGTTTCCACCTTGGTGTCGAAGGG       c.1560
 S  K  S  E  S  E  D  S  I  R  R  K  S  F  H  L  G  V  E  G         p.520

          .         .         .         .   | 12     .         .    g.96181
 CATAGGCGAGCACATGAAAAGAGGTTGTCTACCCCCAATCAG | TCACCACTCAGCATTCGT    c.1620
 H  R  R  A  H  E  K  R  L  S  T  P  N  Q   | S  P  L  S  I  R      p.540

          .         .         .         .         .         .       g.96241
 GGCTCCTTGTTTTCTGCAAGGCGAAGCAGCAGAACAAGTCTTTTTAGTTTCAAAGGCAGA       c.1680
 G  S  L  F  S  A  R  R  S  S  R  T  S  L  F  S  F  K  G  R         p.560

          .         .         .         .         .         .       g.96301
 GGAAGAGATATAGGATCTGAGACTGAATTTGCCGATGATGAGCACAGCATTTTTGGAGAC       c.1740
 G  R  D  I  G  S  E  T  E  F  A  D  D  E  H  S  I  F  G  D         p.580

          .         .         .         .         .         .       g.96361
 AATGAGAGCAGAAGGGGCTCACTGTTTGTGCCCCACAGACCCCAGGAGCGACGCAGCAGT       c.1800
 N  E  S  R  R  G  S  L  F  V  P  H  R  P  Q  E  R  R  S  S         p.600

          .         .         .         .         .         .       g.96421
 AACATCAGCCAAGCCAGTAGGTCCCCACCAATGCTGCCGGTGAACGGGAAAATGCACAGT       c.1860
 N  I  S  Q  A  S  R  S  P  P  M  L  P  V  N  G  K  M  H  S         p.620

          .         .         .         .         .         .       g.96481
 GCTGTGGACTGCAACGGTGTGGTCTCCCTGGTTGATGGACGCTCAGCCCTCATGCTCCCC       c.1920
 A  V  D  C  N  G  V  V  S  L  V  D  G  R  S  A  L  M  L  P         p.640

          .         .  | 13      .         .         .         .    g.99218
 AATGGACAGCTTCTGCCAGAG | GGCACGACCAATCAAATACACAAGAAAAGGCGTTGTAGT    c.1980
 N  G  Q  L  L  P  E   | G  T  T  N  Q  I  H  K  K  R  R  C  S      p.660

          .         .         .         .         .         .       g.99278
 TCCTATCTCCTTTCAGAGGATATGCTGAATGATCCCAACCTCAGACAGAGAGCAATGAGT       c.2040
 S  Y  L  L  S  E  D  M  L  N  D  P  N  L  R  Q  R  A  M  S         p.680

          .         .         .  | 14      .         .         .    g.100421
 AGAGCAAGCATATTAACAAACACTGTGGAAG | AACTTGAAGAGTCCAGACAAAAATGTCCA    c.2100
 R  A  S  I  L  T  N  T  V  E  E |   L  E  E  S  R  Q  K  C  P      p.700

          .         .         .         .         .         .       g.100481
 CCTTGGTGGTACAGATTTGCACACAAATTCTTGATCTGGAATTGCTCTCCATATTGGATA       c.2160
 P  W  W  Y  R  F  A  H  K  F  L  I  W  N  C  S  P  Y  W  I         p.720

          .         .         .         .         .         .       g.100541
 AAATTCAAAAAGTGTATCTATTTTATTGTAATGGATCCTTTTGTAGATCTTGCAATTACC       c.2220
 K  F  K  K  C  I  Y  F  I  V  M  D  P  F  V  D  L  A  I  T         p.740

          .         .         .         .         .         .       g.100601
 ATTTGCATAGTTTTAAACACATTATTTATGGCTATGGAACACCACCCAATGACTGAGGAA       c.2280
 I  C  I  V  L  N  T  L  F  M  A  M  E  H  H  P  M  T  E  E         p.760

          .         .         . | 15       .         .         .    g.102704
 TTCAAAAATGTACTTGCTATAGGAAATTTG | GTCTTTACTGGAATCTTTGCAGCTGAAATG    c.2340
 F  K  N  V  L  A  I  G  N  L   | V  F  T  G  I  F  A  A  E  M      p.780

          .         .         .         .         .         .       g.102764
 GTATTAAAACTGATTGCCATGGATCCATATGAGTATTTCCAAGTAGGCTGGAATATTTTT       c.2400
 V  L  K  L  I  A  M  D  P  Y  E  Y  F  Q  V  G  W  N  I  F         p.800

          .         .         .         .         .         .       g.102824
 GACAGCCTTATTGTGACTTTAAGTTTAGTGGAGCTCTTTCTAGCAGATGTGGAAGGATTG       c.2460
 D  S  L  I  V  T  L  S  L  V  E  L  F  L  A  D  V  E  G  L         p.820

          .         .     | 16   .         .         .         .    g.103684
 TCAGTTCTGCGATCATTCAGACTG | CTCCGAGTCTTCAAGTTGGCAAAATCCTGGCCAACA    c.2520
 S  V  L  R  S  F  R  L   | L  R  V  F  K  L  A  K  S  W  P  T      p.840

          .         .         .         .         .         .       g.103744
 TTGAACATGCTGATTAAGATCATTGGTAACTCAGTAGGGGCTCTAGGTAACCTCACCTTA       c.2580
 L  N  M  L  I  K  I  I  G  N  S  V  G  A  L  G  N  L  T  L         p.860

          .         .         .         .         .         .       g.103804
 GTGTTGGCCATCATCGTCTTCATTTTTGCTGTGGTCGGCATGCAGCTCTTTGGTAAGAGC       c.2640
 V  L  A  I  I  V  F  I  F  A  V  V  G  M  Q  L  F  G  K  S         p.880

          .         .         .         .         .         .       g.103864
 TACAAAGAATGTGTCTGCAAGATCAATGATGACTGTACGCTCCCACGGTGGCACATGAAC       c.2700
 Y  K  E  C  V  C  K  I  N  D  D  C  T  L  P  R  W  H  M  N         p.900

          .         .         .         .         .         .       g.103924
 GACTTCTTCCACTCCTTCCTGATTGTGTTCCGCGTGCTGTGTGGAGAGTGGATAGAGACC       c.2760
 D  F  F  H  S  F  L  I  V  F  R  V  L  C  G  E  W  I  E  T         p.920

          .         .         .         .         .         .       g.103984
 ATGTGGGACTGTATGGAGGTCGCTGGTCAAGCTATGTGCCTTATTGTTTACATGATGGTC       c.2820
 M  W  D  C  M  E  V  A  G  Q  A  M  C  L  I  V  Y  M  M  V         p.940

          .         .  | 17      .         .         .         .    g.108151
 ATGGTCATTGGAAACCTGGTG | GTCCTAAACCTATTTCTGGCCTTATTATTGAGCTCATTT    c.2880
 M  V  I  G  N  L  V   | V  L  N  L  F  L  A  L  L  L  S  S  F      p.960

          .         .         .         .         .         .       g.108211
 AGTTCAGACAATCTTACAGCAATTGAAGAAGACCCTGATGCAAACAACCTCCAGATTGCA       c.2940
 S  S  D  N  L  T  A  I  E  E  D  P  D  A  N  N  L  Q  I  A         p.980

          .         .         .         .         .         .       g.108271
 GTGACTAGAATTAAAAAGGGAATAAATTATGTGAAACAAACCTTACGTGAATTTATTCTA       c.3000
 V  T  R  I  K  K  G  I  N  Y  V  K  Q  T  L  R  E  F  I  L         p.1000

          .         .         .         .         .         .       g.108331
 AAAGCATTTTCCAAAAAGCCAAAGATTTCCAGGGAGATAAGACAAGCAGAAGATCTGAAT       c.3060
 K  A  F  S  K  K  P  K  I  S  R  E  I  R  Q  A  E  D  L  N         p.1020

          .         .         .         .         .         .       g.108391
 ACTAAGAAGGAAAACTATATTTCTAACCATACACTTGCTGAAATGAGCAAAGGTCACAAT       c.3120
 T  K  K  E  N  Y  I  S  N  H  T  L  A  E  M  S  K  G  H  N         p.1040

          .         .         .         .         .         .       g.108451
 TTCCTCAAGGAAAAAGATAAAATCAGTGGTTTTGGAAGCAGCGTGGACAAACACTTGATG       c.3180
 F  L  K  E  K  D  K  I  S  G  F  G  S  S  V  D  K  H  L  M         p.1060

          .         .         .         .         .         .       g.108511
 GAAGACAGTGATGGTCAATCATTTATTCACAATCCCAGCCTCACAGTGACAGTGCCAATT       c.3240
 E  D  S  D  G  Q  S  F  I  H  N  P  S  L  T  V  T  V  P  I         p.1080

          .         .         .         .         .         .       g.108571
 GCACCTGGGGAATCCGATTTGGAAAATATGAATGCTGAGGAACTTAGCAGTGATTCGGAT       c.3300
 A  P  G  E  S  D  L  E  N  M  N  A  E  E  L  S  S  D  S  D         p.1100

          .         | 18         .         .         .         .    g.129144
 AGTGAATACAGCAAAGTG | AGATTAAACCGGTCAAGCTCCTCAGAGTGCAGCACAGTTGAT    c.3360
 S  E  Y  S  K  V   | R  L  N  R  S  S  S  S  E  C  S  T  V  D      p.1120

          .         .         .         .         .         .       g.129204
 AACCCTTTGCCTGGAGAAGGAGAAGAAGCAGAGGCTGAACCTATGAATTCCGATGAGCCA       c.3420
 N  P  L  P  G  E  G  E  E  A  E  A  E  P  M  N  S  D  E  P         p.1140

          .          | 19        .         .         .         .    g.138372
 GAGGCCTGTTTCACAGATG | GTTGTGTACGGAGGTTCTCATGCTGCCAAGTTAACATAGAG    c.3480
 E  A  C  F  T  D  G |   C  V  R  R  F  S  C  C  Q  V  N  I  E      p.1160

          .         .         .         .         .         .       g.138432
 TCAGGGAAAGGAAAAATCTGGTGGAACATCAGGAAAACCTGCTACAAGATTGTTGAACAC       c.3540
 S  G  K  G  K  I  W  W  N  I  R  K  T  C  Y  K  I  V  E  H         p.1180

          .         .         .         .         .     | 20   .    g.142726
 AGTTGGTTTGAAAGCTTCATTGTCCTCATGATCCTGCTCAGCAGTGGTGCCCTG | GCTTTT    c.3600
 S  W  F  E  S  F  I  V  L  M  I  L  L  S  S  G  A  L   | A  F      p.1200

          .         .         .         .         .         .       g.142786
 GAAGATATTTATATTGAAAGGAAAAAGACCATTAAGATTATCCTGGAGTATGCAGACAAG       c.3660
 E  D  I  Y  I  E  R  K  K  T  I  K  I  I  L  E  Y  A  D  K         p.1220

          .         .         .         .         .         .       g.142846
 ATCTTCACTTACATCTTCATTCTGGAAATGCTTCTAAAATGGATAGCATATGGTTATAAA       c.3720
 I  F  T  Y  I  F  I  L  E  M  L  L  K  W  I  A  Y  G  Y  K         p.1240

          .         .         .         .         | 21         .    g.147537
 ACATATTTCACCAATGCCTGGTGTTGGCTGGATTTCCTAATTGTTGAT | GTTTCTTTGGTT    c.3780
 T  Y  F  T  N  A  W  C  W  L  D  F  L  I  V  D   | V  S  L  V      p.1260

          .         .         .         .         .         .       g.147597
 ACTTTAGTGGCAAACACTCTTGGCTACTCAGATCTTGGCCCCATTAAATCCCTTCGGACA       c.3840
 T  L  V  A  N  T  L  G  Y  S  D  L  G  P  I  K  S  L  R  T         p.1280

          .         .         .         .         .  | 22      .    g.152024
 CTGAGAGCTTTAAGACCTCTAAGAGCCTTATCTAGATTTGAAGGAATGAGG | GTCGTTGTG    c.3900
 L  R  A  L  R  P  L  R  A  L  S  R  F  E  G  M  R   | V  V  V      p.1300

          .         .         .         .         .         .       g.152084
 AATGCACTCATAGGAGCAATTCCTTCCATCATGAATGTGCTACTTGTGTGTCTTATATTC       c.3960
 N  A  L  I  G  A  I  P  S  I  M  N  V  L  L  V  C  L  I  F         p.1320

          .         .         .         .         .         .       g.152144
 TGGCTGATATTCAGCATCATGGGAGTAAATTTGTTTGCTGGCAAGTTCTATGAGTGTATT       c.4020
 W  L  I  F  S  I  M  G  V  N  L  F  A  G  K  F  Y  E  C  I         p.1340

          .         .         .         .         .         .       g.152204
 AACACCACAGATGGGTCACGGTTTCCTGCAAGTCAAGTTCCAAATCGTTCCGAATGTTTT       c.4080
 N  T  T  D  G  S  R  F  P  A  S  Q  V  P  N  R  S  E  C  F         p.1360

          .         .         .         .         .         .       g.152264
 GCCCTTATGAATGTTAGTCAAAATGTGCGATGGAAAAACCTGAAAGTGAACTTTGATAAT       c.4140
 A  L  M  N  V  S  Q  N  V  R  W  K  N  L  K  V  N  F  D  N         p.1380

          .         .         .    | 23    .         .         .    g.153291
 GTCGGACTTGGTTACCTATCTCTGCTTCAAGTT | GCAACTTTTAAGGGATGGACGATTATT    c.4200
 V  G  L  G  Y  L  S  L  L  Q  V   | A  T  F  K  G  W  T  I  I      p.1400

          .         .        | 24.         .         .         .    g.154316
 ATGTATGCAGCAGTGGATTCTGTTAAT | GTAGACAAGCAGCCCAAATATGAATATAGCCTC    c.4260
 M  Y  A  A  V  D  S  V  N   | V  D  K  Q  P  K  Y  E  Y  S  L      p.1420

          .         .         .         .         .         .       g.154376
 TACATGTATATTTATTTTGTCGTCTTTATCATCTTTGGGTCATTCTTCACTTTGAACTTG       c.4320
 Y  M  Y  I  Y  F  V  V  F  I  I  F  G  S  F  F  T  L  N  L         p.1440

          .         .         .         .      | 25  .         .    g.176538
 TTCATTGGTGTCATCATAGATAATTTCAACCAACAGAAAAAGAAG | CTTGGAGGTCAAGAC    c.4380
 F  I  G  V  I  I  D  N  F  N  Q  Q  K  K  K   | L  G  G  Q  D      p.1460

          .         .         .         .         .         .       g.176598
 ATCTTTATGACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAGCTGGGGTCCAAG       c.4440
 I  F  M  T  E  E  Q  K  K  Y  Y  N  A  M  K  K  L  G  S  K         p.1480

          .         .         . | 26       .         .         .    g.176792
 AAGCCACAAAAGCCAATTCCTCGACCAGGG | AACAAAATCCAAGGATGTATATTTGACCTA    c.4500
 K  P  Q  K  P  I  P  R  P  G   | N  K  I  Q  G  C  I  F  D  L      p.1500

          .         .         .         .         .         .       g.176852
 GTGACAAATCAAGCCTTTGATATTAGTATCATGGTTCTTATCTGTCTCAACATGGTAACC       c.4560
 V  T  N  Q  A  F  D  I  S  I  M  V  L  I  C  L  N  M  V  T         p.1520

          .         .         .         .         .         .       g.176912
 ATGATGGTAGAAAAGGAGGGTCAAAGTCAACATATGACTGAAGTTTTATATTGGATAAAT       c.4620
 M  M  V  E  K  E  G  Q  S  Q  H  M  T  E  V  L  Y  W  I  N         p.1540

          .         .         .         .         .         .       g.176972
 GTGGTTTTTATAATCCTTTTCACTGGAGAATGTGTGCTAAAACTGATCTCCCTCAGACAC       c.4680
 V  V  F  I  I  L  F  T  G  E  C  V  L  K  L  I  S  L  R  H         p.1560

          .         .         .         .         .         .       g.177032
 TACTACTTCACTGTAGGATGGAATATTTTTGATTTTGTGGTTGTGATTATCTCCATTGTA       c.4740
 Y  Y  F  T  V  G  W  N  I  F  D  F  V  V  V  I  I  S  I  V         p.1580

   | 27      .         .         .         .         .         .    g.181182
 G | GTATGTTTCTAGCTGATTTGATTGAAACGTATTTTGTGTCCCCTACCCTGTTCCGAGTG    c.4800
 G |   M  F  L  A  D  L  I  E  T  Y  F  V  S  P  T  L  F  R  V      p.1600

          .         .         .         .         .         .       g.181242
 ATCCGTCTTGCCAGGATTGGCCGAATCCTACGTCTAGTCAAAGGAGCAAAGGGGATCCGC       c.4860
 I  R  L  A  R  I  G  R  I  L  R  L  V  K  G  A  K  G  I  R         p.1620

          .         .         .         .         .         .       g.181302
 ACGCTGCTCTTTGCTTTGATGATGTCCCTTCCTGCGTTGTTTAACATCGGCCTCCTGCTC       c.4920
 T  L  L  F  A  L  M  M  S  L  P  A  L  F  N  I  G  L  L  L         p.1640

          .         .         .         .         .         .       g.181362
 TTCCTGGTCATGTTCATCTACGCCATCTTTGGAATGTCCAACTTTGCCTATGTTAAAAAG       c.4980
 F  L  V  M  F  I  Y  A  I  F  G  M  S  N  F  A  Y  V  K  K         p.1660

          .         .         .         .         .         .       g.181422
 GAAGATGGAATTAATGACATGTTCAATTTTGAGACCTTTGGCAACAGTATGATTTGCCTG       c.5040
 E  D  G  I  N  D  M  F  N  F  E  T  F  G  N  S  M  I  C  L         p.1680

          .         .         .         .         .         .       g.181482
 TTCCAAATTACAACCTCTGCTGGCTGGGATGGATTGCTAGCACCTATTCTTAACAGTAAG       c.5100
 F  Q  I  T  T  S  A  G  W  D  G  L  L  A  P  I  L  N  S  K         p.1700

          .         .         .         .         .         .       g.181542
 CCACCCGACTGTGACCCAAAAAAAGTTCATCCTGGAAGTTCAGTTGAAGGAGACTGTGGT       c.5160
 P  P  D  C  D  P  K  K  V  H  P  G  S  S  V  E  G  D  C  G         p.1720

          .         .         .         .         .         .       g.181602
 AACCCATCTGTTGGAATATTCTACTTTGTTAGTTATATCATCATATCCTTCCTGGTTGTG       c.5220
 N  P  S  V  G  I  F  Y  F  V  S  Y  I  I  I  S  F  L  V  V         p.1740

          .         .         .         .         .         .       g.181662
 GTGAACATGTACATTGCAGTCATACTGGAGAATTTTAGTGTTGCCACTGAAGAAAGTACT       c.5280
 V  N  M  Y  I  A  V  I  L  E  N  F  S  V  A  T  E  E  S  T         p.1760

          .         .         .         .         .         .       g.181722
 GAACCTCTGAGTGAGGATGACTTTGAGATGTTCTATGAGGTTTGGGAGAAGTTTGATCCC       c.5340
 E  P  L  S  E  D  D  F  E  M  F  Y  E  V  W  E  K  F  D  P         p.1780

          .         .         .         .         .         .       g.181782
 GATGCGACCCAGTTTATAGAGTTCTCTAAACTCTCTGATTTTGCAGCTGCCCTGGATCCT       c.5400
 D  A  T  Q  F  I  E  F  S  K  L  S  D  F  A  A  A  L  D  P         p.1800

          .         .         .         .         .         .       g.181842
 CCTCTTCTCATAGCAAAACCCAACAAAGTCCAGCTCATTGCCATGGATCTGCCCATGGTT       c.5460
 P  L  L  I  A  K  P  N  K  V  Q  L  I  A  M  D  L  P  M  V         p.1820

          .         .         .         .         .         .       g.181902
 AGTGGTGACCGGATCCATTGTCTTGACATCTTATTTGCTTTTACAAAGCGTGTTTTGGGT       c.5520
 S  G  D  R  I  H  C  L  D  I  L  F  A  F  T  K  R  V  L  G         p.1840

          .         .         .         .         .         .       g.181962
 GAGAGTGGGGAGATGGATTCTCTTCGTTCACAGATGGAAGAAAGGTTCATGTCTGCAAAT       c.5580
 E  S  G  E  M  D  S  L  R  S  Q  M  E  E  R  F  M  S  A  N         p.1860

          .         .         .         .         .         .       g.182022
 CCTTCCAAAGTGTCCTATGAACCCATCACAACCACACTAAAACGGAAACAAGAGGATGTG       c.5640
 P  S  K  V  S  Y  E  P  I  T  T  T  L  K  R  K  Q  E  D  V         p.1880

          .         .         .         .         .         .       g.182082
 TCTGCTACTGTCATTCAGCGTGCTTATAGACGTTACCGCTTAAGGCAAAATGTCAAAAAT       c.5700
 S  A  T  V  I  Q  R  A  Y  R  R  Y  R  L  R  Q  N  V  K  N         p.1900

          .         .         .         .         .         .       g.182142
 ATATCAAGTATATACATAAAAGATGGAGACAGAGATGATGATTTACTCAATAAAAAAGAT       c.5760
 I  S  S  I  Y  I  K  D  G  D  R  D  D  D  L  L  N  K  K  D         p.1920

          .         .         .         .         .         .       g.182202
 ATGGCTTTTGATAATGTTAATGAGAACTCAAGTCCAGAAAAAACAGATGCCACTTCATCC       c.5820
 M  A  F  D  N  V  N  E  N  S  S  P  E  K  T  D  A  T  S  S         p.1940

          .         .         .         .         .         .       g.182262
 ACCACCTCTCCACCTTCATATGATAGTGTAACAAAGCCAGACAAAGAGAAATATGAACAA       c.5880
 T  T  S  P  P  S  Y  D  S  V  T  K  P  D  K  E  K  Y  E  Q         p.1960

          .         .         .         .         .                 g.182316
 GACAGAACAGAAAAGGAAGACAAAGGGAAAGACAGCAAGGAAAGCAAAAAATAG             c.5934
 D  R  T  E  K  E  D  K  G  K  D  S  K  E  S  K  K  X               p.1977

          .         .         .         .         .         .       g.182376
 agcttcatttttgatatattgtttacagcctgtgaaagtgatttatttgtgttaataaaa       c.*60

          .         .         .         .         .         .       g.182436
 ctcttttgaggaagtctatgccaaaatcctttttatcaaaatattctcgaaggcagtgca       c.*120

          .         .         .         .         .         .       g.182496
 gtcactaactctgatttcctaagaaaggtgggcagcattagcagatggttatttttgcac       c.*180

          .         .         .         .         .         .       g.182556
 tgatgattctttaagaatcgtaagagaactctgtaggaattattgattatagcatacaaa       c.*240

          .         .         .         .         .         .       g.182616
 agtgattcagttttttggtttttaataaatcagaagaccatgtagaaaacttttacatct       c.*300

          .         .         .         .         .         .       g.182676
 gccttgtcatcttttcacaggattgtaattagtcttgtttcccatgtaaataaacaacac       c.*360

          .         .         .         .         .         .       g.182736
 acgcatacagaaaaatctattatttatctattatttggaaatcaacaaaagtatttgcct       c.*420

          .         .         .         .         .         .       g.182796
 tggctttgcaatgaaatgcttgatagaagtaatggacattagttatgaatgtttagttaa       c.*480

          .         .         .         .         .         .       g.182856
 aatgcattattagggagcttgactttttatcaatgtacagaggttattctatattttgag       c.*540

          .         .         .         .         .         .       g.182916
 gtgcttaaatttattctacattgcatcagaaccaatttatatgtgcctataaaatgccat       c.*600

          .         .         .         .         .         .       g.182976
 gggattaaaaatatatgtaggctattcatttctacaaatgtttttcattcatcttgactc       c.*660

          .         .         .         .         .         .       g.183036
 acatgccaacaaggataagacttacctttagagtattgtgtttcatagcctttcttcttt       c.*720

          .         .         .         .         .         .       g.183096
 catatccctttttgttcatagaataaccacagaacttgaaaaattattctaagtacatat       c.*780

          .         .         .         .         .         .       g.183156
 tacactcctcaaaaaaaacaaagataactgagaaaaaagttattgacagaagttctattt       c.*840

          .         .         .         .         .         .       g.183216
 gctattatttacatagcctaacatttgactgtgctgcccaaaatactgataatagtctct       c.*900

          .         .         .         .         .         .       g.183276
 taaactcttttgtcaaattttcctgctttcttatgcagtattgtttagtcatcctttcgc       c.*960

          .         .         .         .         .         .       g.183336
 tgtaagcaaagttgatgaaatccttcctgatatgcagttagttgtttgaccacggtacat       c.*1020

          .         .         .         .         .         .       g.183396
 acttgagcagataataacttgggcacagtatttattgcatcacttgtatacaatcccgtg       c.*1080

          .         .         .         .         .         .       g.183456
 tttggcaagctttcaaatcatgtaatatgacagactttacacagatatgtgtttagtatg       c.*1140

          .         .         .         .         .         .       g.183516
 aataaaaaagcattgaaatagggattcttgccaacttgctctcttgccaccaacttactt       c.*1200

          .         .         .         .         .         .       g.183576
 tcctaaattatggaagtaatcttttttggatatacttcaatgtatacaatgaggaagatg       c.*1260

          .         .         .         .         .         .       g.183636
 tcaccttctccttaaaattctatgatgtgaaatatattttgcctcaatcaacacagtacc       c.*1320

          .         .         .         .         .         .       g.183696
 atgggcttctaatttatcaagcacatattcattttgcattagctgtagacatctagtttt       c.*1380

          .         .         .         .         .         .       g.183756
 ttgaaaacacctattaatagtaatttgaaaagaaataaccataatgctttttttcgtgag       c.*1440

          .         .         .         .         .         .       g.183816
 tttatttcaggaatatgagatctttcttctataaagttattcatgcacaggcaaaaattg       c.*1500

          .         .         .         .         .         .       g.183876
 agctacacaggtagaatgtagttttacttagaagatttttgtgggaggttttgaagcaaa       c.*1560

          .         .         .         .         .         .       g.183936
 tatataaaacaactttcactaatttgctttccatatttaaaaaataataaattacattta       c.*1620

          .         .         .         .         .         .       g.183996
 tataataaatgtttaaagcacatattttttgttgttctggcaatttaaaaagaaagagga       c.*1680

          .         .         .         .         .         .       g.184056
 tttaaacgtacctatagaaacaaagatttatggttaaagaatgagatcagaagtctagaa       c.*1740

          .         .         .         .         .         .       g.184116
 tgtttttaaattgtgatatattttacaacatccgttattactttgagacatttgtcctaa       c.*1800

          .         .         .         .         .         .       g.184176
 tctacgtataaaactcaatctagggctaaagattctttataccatcttaggttcattcat       c.*1860

          .         .         .         .         .         .       g.184236
 cttaggctatttgaaccactttttaatttaatatgaaagacaccatgcagtgttttccga       c.*1920

          .         .         .         .         .         .       g.184296
 gactacatagatcattttatcacatacctaccaagcctgttggaaataggttttgataat       c.*1980

          .         .         .         .         .         .       g.184356
 ttaagtagggacctatacaaaatatattacatttatcagatttttaaatacattcaatta       c.*2040

          .         .         .         .         .         .       g.184416
 agaatttaacatcaccttaaatttgaattcaatctaccgttatttcaaactcacaaatat       c.*2100

          .         .         .         .         .         .       g.184476
 aactgcattatgaatacttacataatgtagtaagacaagatgtttgacaggttcgtgtgt       c.*2160

          .         .         .         .         .         .       g.184536
 aattttctattaatgtttttacattgccttgtttttatgtaaaataaaaaatatgggcaa       c.*2220

          .         .         .         .         .         .       g.184596
 ctggtttgttaacaacacaatttcttcttagcatttcaaaaatatatataaagttgttct       c.*2280

          .         .         .         .         .         .       g.184656
 ttttcctatttcatgaactatgtttttttttaaaataacatggttaagttttatatatat       c.*2340

          .         .         .         .         .         .       g.184716
 ttacgtttgtttcaggaatgtctacttgtgactttttatcaattaaaaataatatttgga       c.*2400

          .         .         .         .         .         .       g.184776
 agaaagagcttattaagtataagcttgaagtaaaattagacctctctttccatgtagatt       c.*2460

          .         .         .         .         .         .       g.184836
 actgtttgtactgatggtttcacccttcagaaggcactgtcatattaatatttaaatttt       c.*2520

          .         .         .         .         .         .       g.184896
 ataatcgctgaacttattacacccaacaatacagaaaggcagttacactgaagaacttaa       c.*2580

          .         .         .         .         .         .       g.184956
 cttagaataaaatggaagcaaacaggttttctaaaaacttttttaagtgaccaggtctcg       c.*2640

          .         .         .         .         .         .       g.185016
 ctctgtcacccaggctagagtgcaatggcatgatcatagctctctgcagcctcaactctg       c.*2700

          .         .         .         .         .         .       g.185076
 ggctcaagcaaccctcctgcctcagcctcccaagtagctaagactacaggtacatgccac       c.*2760

          .         .         .         .         .         .       g.185136
 catgcctggctaatatttaaatttttgtagataaggggtcttgctatgttgcccaggcta       c.*2820

          .         .         .         .         .         .       g.185196
 gtctcaaactcctggcttcaagtgttcctactgtcatgacctgccaacatgctggggtta       c.*2880

          .         .         .         .         .         .       g.185256
 caggcatgagccaccatgccccaaacaggtttgaacacaaatctttcggatgaaaattag       c.*2940

          .         .         .         .         .         .       g.185316
 agaacctaattttagctttttgatagttacctagtttgcaaaagatttgggtgacttgtg       c.*3000

          .         .         .         .         .         .       g.185376
 agctgtttttaaatgctgattgttgaacatcacaacccaaaatacttagcatgattttat       c.*3060

          .         .         .         .         .         .       g.185436
 agagttttgatagctttattaaaaagagtgaaaataaaatgcatatgtaaataaagcagt       c.*3120

          .         .         .         .         .         .       g.185496
 tctaaatagctatttcagagaaatgttaatagaagtgctgaaagaagggccaactaaatt       c.*3180

          .         .         .         .         .         .       g.185556
 aggatggccagggaattggcctgggtttaggacctatgtatgaaggccaccaatttttta       c.*3240

          .         .         .         .         .         .       g.185616
 aaaatatctgtggtttattatgttattatcttcttgaggaaaacaatcaagaattgcttc       c.*3300

          .         .         .         .         .         .       g.185676
 atgaaaataaataaatagccatgaatatcataaagctgtttacataggattctttacaaa       c.*3360

          .         .         .         .         .         .       g.185736
 tttcatagatctatgaatgctcaaaatgtttgagtttgccataaattatattgtagttat       c.*3420

          .         .         .         .         .         .       g.185796
 attgtagttatacttgagactgacacattgtaatataatctaagaataaaagttatacaa       c.*3480

                                                                    g.185803
 aataaaa                                                            c.*3487

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sodium channel, voltage-gated, type IX, alpha subunit protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center