phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) (PDE4D) - coding DNA reference sequence

(used for mutation description)

(last modified May 3, 2012)


This file was created to facilitate the description of sequence variants in the PDE4D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_027957.1, covering PDE4D transcript NM_001165899.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5006
                                                       agatta       c.-241

 .         .         .         .         .         .                g.5066
 tagcccagcgtacgagaagcacgagtcctatagttggcgtaccctgaggcctgccagttc       c.-181

 .         .         .         .         .         .                g.5126
 ctgccttaatgcatatgtagtcgtaattgagttctgacacggccttggatgtttctgtcc       c.-121

 .         .         .         . | 02       .         .             g.307440
 taaatagctgacattgcatcttcaagactgt | cattccagttggcttttgagtggatacgt    c.-61

 .         .         .         .         .         .                g.307500
 gcagtgagatcattgacactggaaacactagttcccattttaattacttaaaacaccacg       c.-1

          .         .         .         .   | 03     .         .    g.504399
 ATGAAAAGAAATACCTGTGATTTGCTTTCTCGGAGCAAAAGT | GCCTCTGAGGAAACACTA    c.60
 M  K  R  N  T  C  D  L  L  S  R  S  K  S   | A  S  E  E  T  L      p.20

          .         .         .         .         .         .       g.504459
 CATTCCAGTAATGAAGAGGAAGACCCTTTCCGCGGAATGGAACCCTATCTTGTCCGGAGA       c.120
 H  S  S  N  E  E  E  D  P  F  R  G  M  E  P  Y  L  V  R  R         p.40

          .         .         .         .         .         .       g.504519
 CTTTCATGTCGCAATATTCAGCTTCCCCCTCTCGCCTTCAGACAGTTGGAACAAGCTGAC       c.180
 L  S  C  R  N  I  Q  L  P  P  L  A  F  R  Q  L  E  Q  A  D         p.60

          .         .         .         .         .         .       g.504579
 TTGAAAAGTGAATCAGAGAACATTCAACGACCAACCAGCCTCCCCCTGAAGATTCTGCCG       c.240
 L  K  S  E  S  E  N  I  Q  R  P  T  S  L  P  L  K  I  L  P         p.80

          .         .         .   | 04     .         .         .    g.1277159
 CTGATTGCTATCACTTCTGCAGAATCCAGTGG | TTTTGATGTGGACAATGGCACATCTGCG    c.300
 L  I  A  I  T  S  A  E  S  S  G  |  F  D  V  D  N  G  T  S  A      p.100

          .         .         .         .         .         .       g.1277219
 GGACGGAGTCCCTTGGATCCCATGACCAGCCCAGGATCCGGGCTAATTCTCCAAGCAAAT       c.360
 G  R  S  P  L  D  P  M  T  S  P  G  S  G  L  I  L  Q  A  N         p.120

          .         .         .         .         .         .       g.1277279
 TTTGTCCACAGTCAACGACGGGAGTCCTTCCTGTATCGATCCGACAGCGATTATGACCTC       c.420
 F  V  H  S  Q  R  R  E  S  F  L  Y  R  S  D  S  D  Y  D  L         p.140

          .         .         .         .     | 05   .         .    g.1299579
 TCTCCAAAGTCTATGTCCCGGAACTCCTCCATTGCCAGTGATAT | ACACGGAGATGACTTG    c.480
 S  P  K  S  M  S  R  N  S  S  I  A  S  D  I  |  H  G  D  D  L      p.160

          .         .  | 06      .         .         .         .    g.1307876
 ATTGTGACTCCATTTGCTCAG | GTCTTGGCCAGTCTGCGAACTGTACGAAACAACTTTGCT    c.540
 I  V  T  P  F  A  Q   | V  L  A  S  L  R  T  V  R  N  N  F  A      p.180

          .         .         .      | 07  .         .         .    g.1312480
 GCATTAACTAATTTGCAAGATCGAGCACCTAGCAA | AAGATCACCCATGTGCAACCAACCA    c.600
 A  L  T  N  L  Q  D  R  A  P  S  K  |  R  S  P  M  C  N  Q  P      p.200

          .         .      | 08  .         .         .         .    g.1454162
 TCCATCAACAAAGCCACCATAACAG | AGGAGGCCTACCAGAAACTGGCCAGCGAGACCCTG    c.660
 S  I  N  K  A  T  I  T  E |   E  A  Y  Q  K  L  A  S  E  T  L      p.220

          .         .         .         .         .         .       g.1454222
 GAGGAGCTGGACTGGTGTCTGGACCAGCTAGAGACCCTACAGACCAGGCACTCCGTCAGT       c.720
 E  E  L  D  W  C  L  D  Q  L  E  T  L  Q  T  R  H  S  V  S         p.240

          .         | 09         .         .         .         .    g.1499675
 GAGATGGCCTCCAACAAG | TTTAAAAGGATGCTTAATCGGGAGCTCACCCATCTCTCTGAA    c.780
 E  M  A  S  N  K   | F  K  R  M  L  N  R  E  L  T  H  L  S  E      p.260

          .         .         .         .         .   | 10     .    g.1501102
 ATGAGTCGGTCTGGAAATCAAGTGTCAGAGTTTATATCAAACACATTCTTAG | ATAAGCAA    c.840
 M  S  R  S  G  N  Q  V  S  E  F  I  S  N  T  F  L  D |   K  Q      p.280

          .         .         .         .         .         .       g.1501162
 CATGAAGTGGAAATTCCTTCTCCAACTCAGAAGGAAAAGGAGAAAAAGAAAAGACCAATG       c.900
 H  E  V  E  I  P  S  P  T  Q  K  E  K  E  K  K  K  R  P  M         p.300

          .         .         .         .         .         .       g.1501222
 TCTCAGATCAGTGGAGTCAAGAAATTGATGCACAGCTCTAGTCTGACTAATTCAAGTATC       c.960
 S  Q  I  S  G  V  K  K  L  M  H  S  S  S  L  T  N  S  S  I         p.320

          .         .         .         .      | 11  .         .    g.1502211
 CCAAGGTTTGGAGTTAAAACTGAACAAGAAGATGTCCTTGCCAAG | GAACTAGAAGATGTG    c.1020
 P  R  F  G  V  K  T  E  Q  E  D  V  L  A  K   | E  L  E  D  V      p.340

          .         .         .         .         .         .       g.1502271
 AACAAATGGGGTCTTCATGTTTTCAGAATAGCAGAGTTGTCTGGTAACCGGCCCTTGACT       c.1080
 N  K  W  G  L  H  V  F  R  I  A  E  L  S  G  N  R  P  L  T         p.360

          .         .     | 12   .         .         .         .    g.1503215
 GTTATCATGCACACCATTTTTCAG | GAACGGGATTTATTAAAAACATTTAAAATTCCAGTA    c.1140
 V  I  M  H  T  I  F  Q   | E  R  D  L  L  K  T  F  K  I  P  V      p.380

          .         .         .         .         .         .       g.1503275
 GATACTTTAATTACATATCTTATGACTCTCGAAGACCATTACCATGCTGATGTGGCCTAT       c.1200
 D  T  L  I  T  Y  L  M  T  L  E  D  H  Y  H  A  D  V  A  Y         p.400

          .         .         .         .         .         .       g.1503335
 CACAACAATATCCATGCTGCAGATGTTGTCCAGTCTACTCATGTGCTATTATCTACACCT       c.1260
 H  N  N  I  H  A  A  D  V  V  Q  S  T  H  V  L  L  S  T  P         p.420

           | 13        .         .         .         .         .    g.1504557
 GCTTTGGAG | GCTGTGTTTACAGATTTGGAGATTCTTGCAGCAATTTTTGCCAGTGCAATA    c.1320
 A  L  E   | A  V  F  T  D  L  E  I  L  A  A  I  F  A  S  A  I      p.440

          .         .         .         .          | 14        .    g.1515764
 CATGATGTAGATCATCCTGGTGTGTCCAATCAATTTCTGATCAATACAA | ACTCTGAACTT    c.1380
 H  D  V  D  H  P  G  V  S  N  Q  F  L  I  N  T  N |   S  E  L      p.460

          .         .         .         .         .         .       g.1515824
 GCCTTGATGTACAATGATTCCTCAGTCTTAGAGAACCATCATTTGGCTGTGGGCTTTAAA       c.1440
 A  L  M  Y  N  D  S  S  V  L  E  N  H  H  L  A  V  G  F  K         p.480

          .         .         .         .         .         .       g.1515884
 TTGCTTCAGGAAGAAAACTGTGACATTTTCCAGAATTTGACCAAAAAACAAAGACAATCT       c.1500
 L  L  Q  E  E  N  C  D  I  F  Q  N  L  T  K  K  Q  R  Q  S         p.500

          .         .     | 15   .         .         .         .    g.1516662
 TTAAGGAAAATGGTCATTGACATC | GTACTTGCAACAGATATGTCAAAACACATGAATCTA    c.1560
 L  R  K  M  V  I  D  I   | V  L  A  T  D  M  S  K  H  M  N  L      p.520

          .         .         .         .         .         .       g.1516722
 CTGGCTGATTTGAAGACTATGGTTGAAACTAAGAAAGTGACAAGCTCTGGAGTTCTTCTT       c.1620
 L  A  D  L  K  T  M  V  E  T  K  K  V  T  S  S  G  V  L  L         p.540

          .         .        | 16.         .         .         .    g.1517292
 CTTGATAATTATTCCGATAGGATTCAG | GTTCTTCAGAATATGGTGCACTGTGCAGATCTG    c.1680
 L  D  N  Y  S  D  R  I  Q   | V  L  Q  N  M  V  H  C  A  D  L      p.560

          .         .         .         .         .         .       g.1517352
 AGCAACCCAACAAAGCCTCTCCAGCTGTACCGCCAGTGGACGGACCGGATAATGGAGGAG       c.1740
 S  N  P  T  K  P  L  Q  L  Y  R  Q  W  T  D  R  I  M  E  E         p.580

          .         .         .         .         .         .       g.1517412
 TTCTTCCGCCAAGGAGACCGAGAGAGGGAACGTGGCATGGAGATAAGCCCCATGTGTGAC       c.1800
 F  F  R  Q  G  D  R  E  R  E  R  G  M  E  I  S  P  M  C  D         p.600

          .         .         . | 17       .         .         .    g.1518048
 AAGCACAATGCTTCCGTGGAAAAATCACAG | GTGGGCTTCATAGACTATATTGTTCATCCC    c.1860
 K  H  N  A  S  V  E  K  S  Q   | V  G  F  I  D  Y  I  V  H  P      p.620

          .         .         .         .         .         .       g.1518108
 CTCTGGGAGACATGGGCAGACCTCGTCCACCCTGACGCCCAGGATATTTTGGACACTTTG       c.1920
 L  W  E  T  W  A  D  L  V  H  P  D  A  Q  D  I  L  D  T  L         p.640

          .         .         .         .         .         .       g.1518168
 GAGGACAATCGTGAATGGTACCAGAGCACAATCCCTCAGAGCCCCTCTCCTGCACCTGAT       c.1980
 E  D  N  R  E  W  Y  Q  S  T  I  P  Q  S  P  S  P  A  P  D         p.660

          .         .         .         .         .         .       g.1518228
 GACCCAGAGGAGGGCCGGCAGGGTCAAACTGAGAAATTCCAGTTTGAACTAACTTTAGAG       c.2040
 D  P  E  E  G  R  Q  G  Q  T  E  K  F  Q  F  E  L  T  L  E         p.680

          .         .         .         .         .         .       g.1518288
 GAAGATGGTGAGTCAGACACGGAAAAGGACAGTGGCAGTCAAGTGGAAGAAGACACTAGC       c.2100
 E  D  G  E  S  D  T  E  K  D  S  G  S  Q  V  E  E  D  T  S         p.700

          .         .         .         .         .         .       g.1518348
 TGCAGTGACTCCAAGACTCTTTGTACTCAAGACTCAGAGTCTACTGAAATTCCCCTTGAT       c.2160
 C  S  D  S  K  T  L  C  T  Q  D  S  E  S  T  E  I  P  L  D         p.720

          .         .         .         .         .         .       g.1518408
 GAACAGGTTGAAGAGGAGGCAGTAGGGGAAGAAGAGGAAAGCCAGCCTGAAGCCTGTGTC       c.2220
 E  Q  V  E  E  E  A  V  G  E  E  E  E  S  Q  P  E  A  C  V         p.740

          .         .                                               g.1518435
 ATAGATGATCGTTCTCCTGACACGTAA                                        c.2247
 I  D  D  R  S  P  D  T  X                                          p.748

          .         .         .         .         .         .       g.1518495
 cagtgcaaaaactttcatgccttttttttttttaagtagaaaaattgtttccaaagtgca       c.*60

          .         .         .         .         .         .       g.1518555
 tgtcacatgccacaaccacggtcacacctcactgtcatctgccaggacgtttgttgaaca       c.*120

          .         .         .         .         .         .       g.1518615
 aaactgaccttgactactcagtccagcgctcaggaatatcgtaaccagttttttcacctc       c.*180

          .         .         .         .         .         .       g.1518675
 catgtcatccgagcaaggtggacatcttcacgaacagcgtttttaacaagatttcagctt       c.*240

          .         .         .         .         .         .       g.1518735
 ggtagagctgacaaagcagataaaatctactccaaattattttcaagagagtgtgactca       c.*300

          .         .         .         .         .         .       g.1518795
 tcaggcagcccaaaagtttattggacttggggtttctattcctttttatttgtttgcaat       c.*360

          .         .         .         .         .         .       g.1518855
 attttcagaagaaaggcattgcacagagtgaacttaatggacgaagcaacaaatatgtca       c.*420

          .         .         .         .         .         .       g.1518915
 agaacaggacatagcacgaatctgttaccagtaggaggaggatgagccacagaaattgca       c.*480

          .         .         .         .         .         .       g.1518975
 taattttctaatttcaagtcttcctgatacatgactgaatagtgtggttcagtgagctgc       c.*540

          .         .         .         .         .         .       g.1519035
 actgacctctacattttgtatgatatgtaaaacagattttttgtagagcttacttttatt       c.*600

          .         .         .         .         .         .       g.1519095
 attaaatgtattgaggtattatatttaaaaaaaactatgttcagaacttcatctgccact       c.*660

          .         .         .         .         .         .       g.1519155
 ggttatttttttctaaggagtaacttgcaagttttcagtacaaatctgtgctacactgga       c.*720

          .         .         .         .         .         .       g.1519215
 taaaaatctaatttatgaattttacttgcaccttatagttcatagcaattaactgatttg       c.*780

          .         .         .         .         .         .       g.1519275
 tagtgattcattgtttgttttatataccaatgacttccatattttaaaagagaaaaacaa       c.*840

          .         .         .         .         .         .       g.1519335
 ctttatgttgcaggaaaccctttttgtaagtctttattatttactttgcattttgtttca       c.*900

          .         .         .         .         .         .       g.1519395
 ctctttccagataagcagagttgctcttcaccagtgtttttcttcatgtgcaaagtgact       c.*960

          .         .         .         .         .         .       g.1519455
 atttgttctataatacttttatgtgtgttatatcaaatgtgtcttaagcttcatgcaaac       c.*1020

          .         .         .         .         .         .       g.1519515
 tcagtcatcagttcgtgttgtctgaagcaagtgggagatatataaatacccagtagctaa       c.*1080

          .         .         .         .         .         .       g.1519575
 aatggtcagtcttttttagatgttttcctacttagtatctcctaataacgttttgctgtg       c.*1140

          .         .         .         .         .         .       g.1519635
 tcactagatgttcatttcacaagtgcatgtctttctaataatccacacatttcatgctct       c.*1200

          .         .         .         .         .         .       g.1519695
 aataatccacacatttcatgctcatttttattgtttttacagccagttatagtaagaaaa       c.*1260

          .         .         .         .         .         .       g.1519755
 aggtttttccccttgtgctgctttataatttagcgtgtgtctgaaccttatccatgtttg       c.*1320

          .         .         .         .         .         .       g.1519815
 ctagatgaggtcttgtcaaatatatcactaccattgtcaccggtgaaaagaaacaggtag       c.*1380

          .         .         .         .         .         .       g.1519875
 ttaagttagggttaacattcatttcaaccacgaggttgtatatcatgactagcttttact       c.*1440

          .         .         .         .         .         .       g.1519935
 cttggtttacagagaaaagttaaacagccaactaggcagtttttaagaatattaacaata       c.*1500

          .         .         .         .         .         .       g.1519995
 tattaacaaacaccaatacaactaatcctatttggttttaatgatttcaccatgggatta       c.*1560

          .         .         .         .         .         .       g.1520055
 agaactatatcaggaacatccctgagaaacggttttaagtgtagcaactactcttcctta       c.*1620

          .         .         .         .         .         .       g.1520115
 atggacagccacataacgtgtaggaagtcctttatcacttatcctcgatccataagcata       c.*1680

          .         .         .         .         .         .       g.1520175
 tcttgcagaggggaactacttctttaaacacatggagggaaagaagatgatgccactggc       c.*1740

          .         .         .         .         .         .       g.1520235
 accagagggttagtactgtgatgcatcctaaaatatttattatattggtaaaaattctgg       c.*1800

          .         .         .         .         .         .       g.1520295
 ttaaataaaaaattagagatcactcttggctgatttcagcaccaggaactgtattacagt       c.*1860

          .         .         .         .         .         .       g.1520355
 tttagagattaattcctagtgtttacctgattatagcagttggcatcatggggcatttaa       c.*1920

          .         .         .         .         .         .       g.1520415
 ttctgactttatccccacgtcagccttaataaagtcttctttaccttctctatgaagact       c.*1980

          .         .         .         .         .         .       g.1520475
 ttaaagcccaaataatcatttttcacattgatattcaagaattgagatagatagaagcca       c.*2040

          .         .         .         .         .         .       g.1520535
 aagtgggtatctgacaagtggaaaatcaaacgtttaagaagaattacaactctgaaaagc       c.*2100

          .         .         .         .         .         .       g.1520595
 atttatatgtggaacttctcaaggagcctcctggggactggaaagtaagtcatcagccag       c.*2160

          .         .         .         .         .         .       g.1520655
 gcaaatgactcatgctgaagagagtccccatttcagtcccctgagatctagctgatgctt       c.*2220

          .         .         .         .         .         .       g.1520715
 agatcctttgaaataaaaattatgtctttataactctgatcttttacataaagcagaaga       c.*2280

          .         .         .         .         .         .       g.1520775
 ggaatcaactagttaattgcaaggtttctactctgtttcctctgtaaagatcagatggta       c.*2340

          .         .         .         .         .         .       g.1520835
 atctttcaaataagaaaaaaataaagacgtatgtttgaccaagtagtttcacaagaatat       c.*2400

          .         .         .         .         .         .       g.1520895
 ttgggaacttgtttcttttaattttatttgtccctgagtgaagtctagaaagaaaggtaa       c.*2460

          .         .         .         .         .         .       g.1520955
 agagtctagagtttattcctctttccaaaacattctcattcctctcctccctacacttag       c.*2520

          .         .         .         .         .         .       g.1521015
 tatttcccccacagagtgcctagaatcttaataatgaataaaataaaaagcagcaatatg       c.*2580

          .         .         .         .         .         .       g.1521075
 tcattaacaaatccagacctgaaagggtaaagggtttataactgcactaataaagagagg       c.*2640

          .         .         .         .         .         .       g.1521135
 ctctttttttttcttccagtttgttggtttttaatggtaccgtgttgtaaagatacccac       c.*2700

          .         .         .         .         .         .       g.1521195
 taatggacaatcaaattgcagaaaaggctcaatatccaagagacagggactaatgcactg       c.*2760

          .         .         .         .         .         .       g.1521255
 tacaatctgcttatccttgcccttctctcttgccaaagtgtgcttcagaaatatatactg       c.*2820

          .         .         .         .         .         .       g.1521315
 ctttaaaaaagaataaaagaatatccttttacaagtggctttacatttcctaaaatgcca       c.*2880

          .         .         .         .         .         .       g.1521375
 taagaaaatgcaatatctgggtactgtatggggaaaaaaatgtccaagtttgtgtaaaac       c.*2940

          .         .         .         .         .         .       g.1521435
 cagtgcatttcagcttgcaagttactgaacacaataatgctgttttaattttgttttata       c.*3000

          .         .         .         .         .         .       g.1521495
 tcagttaaaattcacaataatgtagatagaacaaattacagacaaggaaagaaaaaactt       c.*3060

          .         .         .         .         .         .       g.1521555
 gaatgaaatggattttacagaaagctttatgataatttttgaatgcattatttatttttt       c.*3120

          .         .         .         .         .         .       g.1521615
 gtgccatgcattttttttctcaccaaatgaccttacctgtaatacagtcttgtttgtctg       c.*3180

          .         .         .         .         .         .       g.1521675
 tttacaaccatgtatttattgcaatgtacatactgtaatgttaattgtaaattatctgtt       c.*3240

          .         .         .         .         .         .       g.1521735
 cttattaaaacatcatcccatgatgggatggtgttgatatatttggaaactcttggtgag       c.*3300

          .         .         .         .         .         .       g.1521795
 agaatgaatggtgtgtatacatactctgtacatttttcttttctcctgtaatatagtctt       c.*3360

          .         .         .         .         .         .       g.1521855
 gtcaccttagagcttgtttatggaagattcaagaaaactataaaatacttaaagatatat       c.*3420

          .         .         .         .         .         .       g.1521915
 aaatttaaaaaaacatagctgcaggtctttggtcccagggctgtgccttaactttaacca       c.*3480

          .         .         .         .         .         .       g.1521975
 atattttcttctgttttgctgcatttgaaaggtaacagtggagctagggctgggcatttt       c.*3540

          .         .         .         .         .         .       g.1522035
 acatccaggcttttaattgattagaattctgccaataggtggattttacaaaaccacaga       c.*3600

          .         .         .         .         .         .       g.1522095
 caacctctgaaagattctgagacccttttgagacagaagctcttaagtacttcttgccag       c.*3660

          .         .         .         .         .         .       g.1522155
 ggagcagcactgcatgtgtgatggttgtttgccatctgttgatcaggaactacttcagct       c.*3720

          .         .         .         .         .         .       g.1522215
 acttgcatttgattatttcctttttttttttttttaactcggaaacacaactggggaaat       c.*3780

          .         .         .         .         .         .       g.1522275
 atattctttcccagtgattataaacaatctttttcttttttttaagtccttttggcttct       c.*3840

          .         .         .         .         .         .       g.1522335
 agagctcataggaaaatggacttgatttgaaattggagccagagtttactcgtgttggtt       c.*3900

          .         .         .         .         .         .       g.1522395
 atctattcatcagcttcctgacatgttaagagaatacattaaagagaaaatactgttttt       c.*3960

          .         .         .         .         .         .       g.1522455
 taatcctaaaatttttcttccactaagataaaccaaatgtccttacatatatgtaaaccc       c.*4020

          .         .         .         .         .         .       g.1522515
 atctatttaaacgcaaaggtgggttgatgtcagtttacatagcagaaagcattcactatc       c.*4080

          .         .         .         .         .         .       g.1522575
 ctctaagatttgtttctgcaaaactttcattgctttagaattttaaaatttcaccttgta       c.*4140

          .         .         .         .         .         .       g.1522635
 caatggccagcccctaaagcaggaaacatttataatggattatatggaaacatcctccca       c.*4200

          .         .         .         .         .         .       g.1522695
 gtacttgcccagcccttgaatcatgtggcttttcagtgaaaggaaagattctttttctag       c.*4260

          .         .         .         .         .         .       g.1522755
 gaaaaatgagcctattttattttattttattttattttttgacacaaactgtagatttta       c.*4320

          .         .         .         .         .         .       g.1522815
 gcagccctggcccaaaggaatttgattacttttgttttaaacagtacaaaggggacacta       c.*4380

          .         .         .         .         .         .       g.1522875
 taattacaaaaacatccttaactgatttgagttgtttttatttctttggatatattttca       c.*4440

          .         .         .         .         .         .       g.1522935
 gagtggtaaattgtgtgtgagaattacaaatgattattcttttagtggtttcttagcctc       c.*4500

          .         .         .         .         .         .       g.1522995
 tcttacagcccacggggatagtactgtacatcaataccttcatatgaaatttttatatgc       c.*4560

          .         .         .         .         .         .       g.1523055
 aatgaaaataaaagcatgggttgattctgcctatttatgactcaatcttttacaaataaa       c.*4620

          .         .         .         .         .         .       g.1523115
 agattattcattttaaattatagttcaatcagcatgtctcttaggatactgaacgtggtt       c.*4680

          .         .         .         .         .         .       g.1523175
 gaaatgaaaggatagtgacatcataagttagtactgatattcataaccaaataaagccaa       c.*4740

          .         .         .         .         .         .       g.1523235
 cttgagtaattttgctacattaaaaattaccaaaattacttagatggcctataagattaa       c.*4800

          .         .         .         .         .         .       g.1523295
 gcatggtgttttctaagcaagctttgaaaggggccttccatacttacttaattgaatatt       c.*4860

          .         .         .         .         .         .       g.1523355
 ctgggatattgaaaattattcagatacttgacaattatttttggttacctactccgcaaa       c.*4920

          .         .         .         .         .         .       g.1523415
 ctacaaagttttaaggactcaacaataagttaatgagacacagtgtttgctttcatggag       c.*4980

          .         .         .         .         .         .       g.1523475
 cttacagtctggaggggacaaaggcttaaacaatactcatataattatatatgtgatcag       c.*5040

          .         .         .         .         .         .       g.1523535
 tacaatgaaggagctcagtggggtaaataagcaggaacctgaacttgatctgttccggag       c.*5100

          .         .         .         .         .         .       g.1523595
 ggccacagaaggcttccttgaggccttgagaaagtgatttgcatctgagttctgaaggat       c.*5160

          .         .         .         .         .         .       g.1523655
 tgtaagaggtaactagggaaaaagttgacaggaagaggaaggggatccagacaagaaaca       c.*5220

          .         .         .         .         .         .       g.1523715
 tttgcaaagatcttgaggcataaatgagcttgagacatctggagaaactgaggaaaagtg       c.*5280

          .         .         .         .         .         .       g.1523775
 agagagtaggcagggcctggagccgcagagccattgctaaccatcctgtgtgagatatcc       c.*5340

          .         .         .         .         .         .       g.1523835
 cccattctgtagctttattctcataaccctgctcaattttctttataacacttctcacag       c.*5400

          .         .         .         .         .         .       g.1523895
 atttatatacgtgtttgtttttgttatctgtctctcccaccagaccacagctccatgaga       c.*5460

          .         .         .         .         .         .       g.1523955
 gcaaggtctttgcttaccaatatatcactagcacttaaaactatgcctggtacacagtag       c.*5520

          .         .         .         .         .         .       g.1524015
 gttcttaatatgtgttgaatatagccatcaaattgatattggatataattcaatctgata       c.*5580

          .         .         .         .                           g.1524061
 agatattttgagatattaaagagtttttaacttgataccataaaaa                     c.*5626

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center