GLE1 RNA export mediator homolog (yeast) (GLE1) - coding DNA reference sequence

(used for mutation description)

(last modified June 18, 2012)


This file was created to facilitate the description of sequence variants in the GLE1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012073.1, covering GLE1 transcript NM_001003722.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5054
       gctgtgctgcgcgcgcgtcccggaagcagaagcctgtgtggccttcccggcggc       c.-61

 .         .         .         .         .         .                g.5114
 tgattcgagggcttgtttggtcagaaggggggcgtcagagaagctgccccttagccaacc       c.-1

          .         .         .         .         .         .       g.5174
 ATGCCGTCTGAGGGTCGCTGCTGGGAGACCTTGAAGGCCCTACGCAGTTCCGACAAAGGT       c.60
 M  P  S  E  G  R  C  W  E  T  L  K  A  L  R  S  S  D  K  G         p.20

          .         .         .          | 02        .         .    g.9205
 CGCCTTTGCTACTACCGCGACTGGCTGCTGCGGCGCGAG | GATGTTTTAGAAGAATGTATG    c.120
 R  L  C  Y  Y  R  D  W  L  L  R  R  E   | D  V  L  E  E  C  M      p.40

          .         .         .         .         .         .       g.9265
 TCTCTTCCCAAGCTATCTTCTTATTCTGGATGGGTGGTAGAGCACGTCCTACCCCATATG       c.180
 S  L  P  K  L  S  S  Y  S  G  W  V  V  E  H  V  L  P  H  M         p.60

          .         .         .         .         .         .       g.9325
 CAGGAGAACCAACCTCTGTCTGAGACTTCGCCATCCTCTACGTCAGCTTCAGCCCTAGAT       c.240
 Q  E  N  Q  P  L  S  E  T  S  P  S  S  T  S  A  S  A  L  D         p.80

          .         .         .         .         .         .       g.9385
 CAACCCTCATTTGTTCCCAAATCTCCTGACGCAAGCTCTGCCTTTTCCCCAGCCTCCCCT       c.300
 Q  P  S  F  V  P  K  S  P  D  A  S  S  A  F  S  P  A  S  P         p.100

          .         .  | 03      .         .         .         .    g.15876
 GCAACACCAAATGGAACCAAG | GGCAAAGATGAGTCCCAGCACACAGAATCTATGGTACTT    c.360
 A  T  P  N  G  T  K   | G  K  D  E  S  Q  H  T  E  S  M  V  L      p.120

          .         .         .         .         .         .       g.15936
 CAGTCCTCACGGGGGATCAAAGTGGAAGGCTGCGTCCGAATGTACGAACTGGTACACAGA       c.420
 Q  S  S  R  G  I  K  V  E  G  C  V  R  M  Y  E  L  V  H  R         p.140

          .   | 04     .         .         .         .         .    g.23024
 ATGAAAGGAACA | GAGGGCCTGAGGCTATGGCAGGAGGAGCAGGAGAGGAAGGTGCAAGCC    c.480
 M  K  G  T   | E  G  L  R  L  W  Q  E  E  Q  E  R  K  V  Q  A      p.160

          .         .         .         .         .         .       g.23084
 CTCTCGGAGATGGCATCTGAACAACTGAAGCGGTTTGATGAATGGAAGGAACTGAAGCAG       c.540
 L  S  E  M  A  S  E  Q  L  K  R  F  D  E  W  K  E  L  K  Q         p.180

          .         .         .         .  | 05      .         .    g.23607
 CATAAAGAATTCCAGGACTTGCGGGAAGTAATGGAGAAGAG | CTCCAGAGAAGCCTTGGGA    c.600
 H  K  E  F  Q  D  L  R  E  V  M  E  K  S  |  S  R  E  A  L  G      p.200

          .         .         .         .   | 06     .         .    g.23918
 CACCAAGAGAAGCTAAAAGCTGAGCACCGTCACAGAGCAAAG | ATTCTCAACCTGAAGCTG    c.660
 H  Q  E  K  L  K  A  E  H  R  H  R  A  K   | I  L  N  L  K  L      p.220

          .         .         .         .         .         .       g.23978
 CGGGAAGCAGAGCAGCAGCGCGTGAAGCAAGCAGAACAGGAGCGGCTTCGGAAGGAAGAA       c.720
 R  E  A  E  Q  Q  R  V  K  Q  A  E  Q  E  R  L  R  K  E  E         p.240

          .         .         .         .         .         .       g.24038
 GGCCAGATCCGCCTGCGGGCCCTCTATGCTCTGCAGGAGGAGATGCTGCAGCTCAGCCAG       c.780
 G  Q  I  R  L  R  A  L  Y  A  L  Q  E  E  M  L  Q  L  S  Q         p.260

          .         .         .         .         .         .       g.24098
 CAGCTGGATGCCTCTGAGCAGCACAAAGCCCTGCTTAAGGTCGACCTGGCTGCCTTCCAG       c.840
 Q  L  D  A  S  E  Q  H  K  A  L  L  K  V  D  L  A  A  F  Q         p.280

          .         .         .         .         .        | 07.    g.25503
 ACCCGAGGCAACCAGCTGTGCAGCCTCATCTCAGGGATCATCCGGGCCTCTTCAGAG | AGC    c.900
 T  R  G  N  Q  L  C  S  L  I  S  G  I  I  R  A  S  S  E   | S      p.300

          .         .         .         .         .         .       g.25563
 AGCTATCCCACAGCAGAGAGTCAAGCTGAGGCTGAGCGAGCTCTGCGGGAAATGCGGGAC       c.960
 S  Y  P  T  A  E  S  Q  A  E  A  E  R  A  L  R  E  M  R  D         p.320

          .         .         .         .         .         .       g.25623
 CTCCTGATGAACTTGGGGCAGGAGATCACCAGAGCCTGCGAAGACAAGAGGAGGCAGGAT       c.1020
 L  L  M  N  L  G  Q  E  I  T  R  A  C  E  D  K  R  R  Q  D         p.340

          .         .         .         .         .         .       g.25683
 GAAGAAGAGGCCCAGGTAAAGCTGCAAGAGGCACAGATGCAGCAGGGACCAGAGGCCCAC       c.1080
 E  E  E  A  Q  V  K  L  Q  E  A  Q  M  Q  Q  G  P  E  A  H         p.360

          .         .         .         .          | 08        .    g.27498
 AAAGAGCCCCCAGCTCCCAGCCAGGGCCCAGGAGGGAAACAGAATGAAG | ACCTCCAGGTG    c.1140
 K  E  P  P  A  P  S  Q  G  P  G  G  K  Q  N  E  D |   L  Q  V      p.380

          .         .         .         .         .         .       g.27558
 AAGGTACAAGACATTACAATGCAGTGGTACCAGCAGCTGCAGGATGCTTCCATGCAGTGT       c.1200
 K  V  Q  D  I  T  M  Q  W  Y  Q  Q  L  Q  D  A  S  M  Q  C         p.400

          .         .         .         .   | 09     .         .    g.27782
 GTGTTGACCTTTGAGGGCCTGACCAACAGCAAGGACAGTCAG | GCCAAAAAGATAAAGATG    c.1260
 V  L  T  F  E  G  L  T  N  S  K  D  S  Q   | A  K  K  I  K  M      p.420

          .         .         .         .         .   | 10     .    g.33829
 GACCTCCAGAAGGCTGCTACCATCCCAGTGAGCCAAATCTCTACCATTGCAG | GCTCAAAA    c.1320
 D  L  Q  K  A  A  T  I  P  V  S  Q  I  S  T  I  A  G |   S  K      p.440

          .         .         .         .         .         .       g.33889
 CTGAAGGAGATCTTTGACAAGATCCACAGCCTGCTCTCTGGAAAACCTGTTCAATCTGGT       c.1380
 L  K  E  I  F  D  K  I  H  S  L  L  S  G  K  P  V  Q  S  G         p.460

          .         .         .         .         .         .       g.33949
 GGGCGCTCTGTGTCTGTCACACTTAACCCACAGGGGCTGGACTTTGTTCAATACAAACTG       c.1440
 G  R  S  V  S  V  T  L  N  P  Q  G  L  D  F  V  Q  Y  K  L         p.480

          .      | 11  .         .         .         .         .    g.34114
 GCAGAGAAATTTGTG | AAACAAGGCGAGGAGGAAGTGGCCTCTCACCATGAAGCAGCATTC    c.1500
 A  E  K  F  V   | K  Q  G  E  E  E  V  A  S  H  H  E  A  A  F      p.500

          .         .         .         .         .         .       g.34174
 CCCATTGCAGTTGTGGCATCCGGGATCTGGGAGCTCCACCCCAGAGTGGGGGACCTCATT       c.1560
 P  I  A  V  V  A  S  G  I  W  E  L  H  P  R  V  G  D  L  I         p.520

          .         .         .         .         .         .       g.34234
 CTTGCTCATCTACATAAGAAGTGTCCTTACTCTGTTCCTTTCTATCCCACTTTCAAGGAG       c.1620
 L  A  H  L  H  K  K  C  P  Y  S  V  P  F  Y  P  T  F  K  E         p.540

          .         .       | 12 .         .         .         .    g.36697
 GGAATGGCTTTGGAAGACTATCAGAG | GATGCTTGGTTACCAAGTAAAGGATTCCAAAGTG    c.1680
 G  M  A  L  E  D  Y  Q  R  |  M  L  G  Y  Q  V  K  D  S  K  V      p.560

          .         .         .         .         .         .       g.36757
 GAGCAGCAAGACAACTTTCTAAAACGCATGTCAGGGATGATCCGTCTCTACGCTGCTATC       c.1740
 E  Q  Q  D  N  F  L  K  R  M  S  G  M  I  R  L  Y  A  A  I         p.580

          .         .         .       | 13 .         .         .    g.38318
 ATCCAGCTCCGGTGGCCATATGGAAACCGACAGGAG | ATTCACCCTCATGGCTTAAATCAT    c.1800
 I  Q  L  R  W  P  Y  G  N  R  Q  E   | I  H  P  H  G  L  N  H      p.600

          .         .         .         .         .         .       g.38378
 GGATGGCGCTGGTTGGCACAGATCTTAAACATGGAGCCCTTGTCAGATGTGACAGCCACC       c.1860
 G  W  R  W  L  A  Q  I  L  N  M  E  P  L  S  D  V  T  A  T         p.620

          .         .  | 14      .         .         .         .    g.39963
 CTCCTCTTTGACTTCCTGGAG | GTGTGTGGGAATGCCCTCATGAAGCAATACCAGGTTCAG    c.1920
 L  L  F  D  F  L  E   | V  C  G  N  A  L  M  K  Q  Y  Q  V  Q      p.640

          .         .         .         .     | 15   .         .    g.40599
 TTCTGGAAGATGCTAATTCTCATCAAAGAGGACTACTTTCCCAG | AATTGAAGCTATCACA    c.1980
 F  W  K  M  L  I  L  I  K  E  D  Y  F  P  R  |  I  E  A  I  T      p.660

          .         .         .         .         | 16         .    g.41422
 AGCTCAGGACAGATGGGCTCCTTCATACGCCTCAAGCAGTTCTTGGAG | AAATGTTTGCAA    c.2040
 S  S  G  Q  M  G  S  F  I  R  L  K  Q  F  L  E   | K  C  L  Q      p.680

          .         .         .         .         .                 g.41479
 CACAAGGACATTCCTGTCCCCAAGGGCTTTCTGACTTCCTCCTTCTGGCGCTCCTGA          c.2097
 H  K  D  I  P  V  P  K  G  F  L  T  S  S  F  W  R  S  X            p.698

          .         .         .         .         .         .       g.41539
 tgtcactccatcacccaccatcaccgctgctgcaaagaggcaataataaaggaactgaag       c.*60

          .         .         .         .         .         .       g.41599
 acagctgtatttgggagaagtcatgtcagattcagaaatttgccattatgtatttttatg       c.*120

          .         .         .         .         .         .       g.41659
 tatttatgccttgtgactaggagaggagattttcatgggtcacaaaattcttggaggtcc       c.*180

          .         .         .         .         .         .       g.41719
 cttagtagatttggtagttccttaagagatccacgtgataaaataaatggagttggcctt       c.*240

          .         .         .         .         .         .       g.41779
 tcttgttttttgcaaaagtgataaaaggtctttagcacttggtctcctcccttgtctcta       c.*300

          .         .         .         .         .         .       g.41839
 gtgtctttcagaaagttggcaataccttaacaaatgcactctgagctggagggagcccac       c.*360

          .         .         .         .         .         .       g.41899
 catttgcacccacctacccaccctcacccctgttcagatgaatttccagaaagagctaag       c.*420

          .         .         .         .         .         .       g.41959
 gctcataaggttcccttttaagtattatttaatagttgaggccagatacttacatgcaag       c.*480

          .         .         .         .         .         .       g.42019
 tctgggttatggttgttttgcctttctcagcttgtgaagtcattctaaagctagaggaag       c.*540

          .         .         .         .         .         .       g.42079
 tatgtgatatacacatggactaaggctcaggtgacactatggctagattaacatctggga       c.*600

          .         .         .         .         .         .       g.42139
 ttaggactggaaacacatgtcattttgaactaagggaaactctttgtcatcctaatttgg       c.*660

          .         .         .         .         .         .       g.42199
 aatttggtccctggatggctagggatccatgaaccaggcaggtaccttttttgtttttgt       c.*720

          .         .         .         .         .         .       g.42259
 tttgttttgtttcttttctgtttgaattaagatgggctaagatggggcttgcaacattaa       c.*780

          .         .         .         .         .         .       g.42319
 acatgagctgagcatccataagcattgaattgggattaaataaagatgttgggcaggaac       c.*840

          .         .         .         .         .         .       g.42379
 tgaacactgctaatatgatgataaatatgcctgactaaagccactacagaaatccagaga       c.*900

          .         .         .         .         .         .       g.42439
 ttggctgttaaaatttgttttgtggaaagactaattctctttgatactgcagaggcagtg       c.*960

          .         .         .         .         .         .       g.42499
 gccatggatctgttcctctgtgctaaatgtcttgtggcagggtgtgtttgtgggggagtg       c.*1020

          .         .         .         .         .         .       g.42559
 ttcactggtactcttgagtggcctgaagtgacccattctatgaattgttaattaaggtgc       c.*1080

          .         .         .         .         .                 g.42610
 caaaaaaaattaataataaagcttggttttttgaaaaacccattgctgata                c.*1131

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The GLE1 RNA export mediator homolog (yeast) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center