electron-transferring-flavoprotein dehydrogenase (ETFDH) - coding DNA reference sequence

(used for mutation description)

(last modified June 14, 2013)


This file was created to facilitate the description of sequence variants in the ETFDH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007078.2, covering ETFDH transcript NM_004453.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.4815
                             gtgctgtgggattcgcggacccctctggccgc       c.-301

 .         .         .         .         .         .                g.4875
 gctgtggctgtttcaccgctccccggctgggacttggagtcccttatctttccctggttt       c.-241

 .         .         .         .         .         .                g.4935
 ggtacatgacccggaagcctcggctggccgttgcgtcatccatggcgccggcgcagagcg       c.-181

 .         .         .         .         .         .                g.4995
 agaaggaggtgggaacgccgtgaagcaagagcggtcggcagagcggggaggcgaactgca       c.-121

 .         .         .         .         .         .                g.5055
 gcagagttcttgctttccggcaggtgatggcgccccccgcggcctagaggtccagcgccc       c.-61

 .         .         .         .         .         .                g.5115
 gccgcgagcagcggacagtcctcctgttgtgtccgaccgagagtcctggtgactttgaac       c.-1

          .         .         .     | 02   .         .         .    g.13151
 ATGCTGGTGCCGCTAGCCAAGCTGTCCTGCCTGG | CATATCAGTGCTTTCATGCCTTAAAA    c.60
 M  L  V  P  L  A  K  L  S  C  L  A |   Y  Q  C  F  H  A  L  K      p.20

          .         .         .         .         .         .       g.13211
 ATTAAGAAAAATTATCTACCTCTATGTGCTACAAGATGGTCTTCAACTTCTACTGTGCCT       c.120
 I  K  K  N  Y  L  P  L  C  A  T  R  W  S  S  T  S  T  V  P         p.40

          .         .         .         .         .      | 03  .    g.14858
 CGAATTACTACCCATTATACTATTTATCCCCGGGATAAGGACAAGAGATGGGAAG | GAGTG    c.180
 R  I  T  T  H  Y  T  I  Y  P  R  D  K  D  K  R  W  E  G |   V      p.60

          .         .         .         .         .         .       g.14918
 AACATGGAAAGGTTTGCAGAAGAAGCAGATGTTGTAATAGTTGGTGCAGGCCCTGCAGGG       c.240
 N  M  E  R  F  A  E  E  A  D  V  V  I  V  G  A  G  P  A  G         p.80

          .         .         .         .         .         .       g.14978
 CTCTCTGCAGCTGTTCGTCTAAAACAGTTGGCTGTGGCACATGAAAAGGACATCCGTGTG       c.300
 L  S  A  A  V  R  L  K  Q  L  A  V  A  H  E  K  D  I  R  V         p.100

          .         .         .         .         .         .       g.15038
 TGTCTAGTGGAGAAAGCTGCCCAGATAGGAGCTCATACTCTCTCAGGGGCTTGCCTTGAT       c.360
 C  L  V  E  K  A  A  Q  I  G  A  H  T  L  S  G  A  C  L  D         p.120

          .         .         .         .      | 04  .         .    g.17265
 CCAGGTGCTTTTAAAGAACTCTTCCCAGACTGGAAAGAGAAGGGG | GCTCCACTTAACACT    c.420
 P  G  A  F  K  E  L  F  P  D  W  K  E  K  G   | A  P  L  N  T      p.140

          .         .         .         .         .         .       g.17325
 CCTGTAACAGAAGACAGATTTGGAATTTTAACAGAGAAATACAGAATTCCTGTGCCAATT       c.480
 P  V  T  E  D  R  F  G  I  L  T  E  K  Y  R  I  P  V  P  I         p.160

         | 05.         .         .         .         .         .    g.17812
 CTTCCAG | GGCTTCCAATGAATAATCATGGCAATTACATTGTACGCTTGGGACATTTAGTG    c.540
 L  P  G |   L  P  M  N  N  H  G  N  Y  I  V  R  L  G  H  L  V      p.180

          .         .         .         .         .         .       g.17872
 AGCTGGATGGGCGAACAAGCAGAAGCCCTTGGTGTTGAAGTATACCCTGGTTATGCAGCT       c.600
 S  W  M  G  E  Q  A  E  A  L  G  V  E  V  Y  P  G  Y  A  A         p.200

        | 06 .         .         .         .         .         .    g.23060
 GCTGAG | GTCCTTTTTCATGATGATGGTAGTGTAAAAGGAATTGCCACTAACGATGTAGGG    c.660
 A  E   | V  L  F  H  D  D  G  S  V  K  G  I  A  T  N  D  V  G      p.220

          .         .     | 07   .         .         .         .    g.28191
 ATACAAAAGGATGGTGCACCAAAG | GCAACATTTGAGAGAGGACTGGAACTACATGCTAAA    c.720
 I  Q  K  D  G  A  P  K   | A  T  F  E  R  G  L  E  L  H  A  K      p.240

          .         .         .         .         .         .       g.28251
 GTCACAATTTTTGCAGAAGGTTGCCATGGACATCTAGCCAAGCAACTATATAAGAAGTTT       c.780
 V  T  I  F  A  E  G  C  H  G  H  L  A  K  Q  L  Y  K  K  F         p.260

          .         .         .         .         .  | 08      .    g.30226
 GATTTGAGAGCAAATTGTGAACCTCAAACCTACGGGATTGGACTGAAGGAG | TTATGGGTT    c.840
 D  L  R  A  N  C  E  P  Q  T  Y  G  I  G  L  K  E   | L  W  V      p.280

          .         .         .         .         .         .       g.30286
 ATTGATGAAAAGAACTGGAAACCTGGGAGAGTAGATCACACTGTTGGTTGGCCCTTGGAC       c.900
 I  D  E  K  N  W  K  P  G  R  V  D  H  T  V  G  W  P  L  D         p.300

          .         .         .         .         .         .       g.30346
 AGACATACCTATGGAGGATCTTTCCTCTATCATTTGAATGAAGGTGAACCCCTAGTAGCT       c.960
 R  H  T  Y  G  G  S  F  L  Y  H  L  N  E  G  E  P  L  V  A         p.320

          .   | 09     .         .         .         .         .    g.31693
 CTTGGTCTTGTG | GTTGGTCTAGACTATCAGAATCCATACCTGAGTCCATTTAGAGAGTTC    c.1020
 L  G  L  V   | V  G  L  D  Y  Q  N  P  Y  L  S  P  F  R  E  F      p.340

          .         .         .         .         .         .       g.31753
 CAAAGGTGGAAACACCATCCTAGCATTCGGCCAACCTTGGAAGGTGGAAAAAGGATTGCA       c.1080
 Q  R  W  K  H  H  P  S  I  R  P  T  L  E  G  G  K  R  I  A         p.360

          .         .         .       | 10 .         .         .    g.36105
 TACGGAGCCAGAGCTCTCAATGAAGGTGGCTTTCAG | TCTATACCAAAACTCACCTTTCCT    c.1140
 Y  G  A  R  A  L  N  E  G  G  F  Q   | S  I  P  K  L  T  F  P      p.380

          .         .         .         .         .         .       g.36165
 GGTGGTTTACTAATTGGTTGTAGTCCTGGTTTTATGAATGTTCCCAAGATCAAAGGTACT       c.1200
 G  G  L  L  I  G  C  S  P  G  F  M  N  V  P  K  I  K  G  T         p.400

          .         .         .         .         .         .       g.36225
 CACACAGCAATGAAAAGTGGAATTTTAGCAGCAGAATCTATTTTTAATCAACTAACTAGT       c.1260
 H  T  A  M  K  S  G  I  L  A  A  E  S  I  F  N  Q  L  T  S         p.420

          .         .      | 11  .         .         .         .    g.38882
 GAAAATCTCCAATCAAAGACAATAG | GACTCCATGTAACTGAATATGAGGACAATTTGAAG    c.1320
 E  N  L  Q  S  K  T  I  G |   L  H  V  T  E  Y  E  D  N  L  K      p.440

          .         .         .         .         .         .       g.38942
 AACTCATGGGTATGGAAAGAGCTATATTCTGTTAGAAATATAAGACCGTCCTGCCACGGA       c.1380
 N  S  W  V  W  K  E  L  Y  S  V  R  N  I  R  P  S  C  H  G         p.460

          .         .         .         .         .         .       g.39002
 GTACTGGGTGTATATGGAGGGATGATTTACACTGGAATCTTTTACTGGATATTGAGAGGA       c.1440
 V  L  G  V  Y  G  G  M  I  Y  T  G  I  F  Y  W  I  L  R  G         p.480

          .         .         | 12         .         .         .    g.39319
 ATGGAGCCGTGGACTCTGAAACATAAAG | GTTCTGACTTTGAACGGCTCAAGCCAGCCAAG    c.1500
 M  E  P  W  T  L  K  H  K  G |   S  D  F  E  R  L  K  P  A  K      p.500

          .         .         .         .         .         .       g.39379
 GATTGCACACCTATTGAGTATCCAAAACCCGATGGACAGATCAGTTTTGACCTCTTGTCA       c.1560
 D  C  T  P  I  E  Y  P  K  P  D  G  Q  I  S  F  D  L  L  S         p.520

          .         .         .         .         .         .       g.39439
 TCTGTGGCTCTGAGTGGTACTAATCATGAACATGACCAGCCGGCACACTTAACCTTAAGG       c.1620
 S  V  A  L  S  G  T  N  H  E  H  D  Q  P  A  H  L  T  L  R         p.540

          .         .         .         .         .         .       g.39499
 GATGACAGTATACCTGTAAATAGAAATCTGTCGATATATGATGGGCCCGAGCAGCGATTC       c.1680
 D  D  S  I  P  V  N  R  N  L  S  I  Y  D  G  P  E  Q  R  F         p.560

          . | 13       .         .         .         .         .    g.41072
 TGTCCTGCAG | GAGTTTATGAATTTGTACCTGTGGAACAAGGTGATGGATTTCGGTTACAG    c.1740
 C  P  A  G |   V  Y  E  F  V  P  V  E  Q  G  D  G  F  R  L  Q      p.580

          .         .         .         .         .         .       g.41132
 ATAAATGCTCAGAACTGTGTACATTGTAAAACATGTGATATTAAAGATCCAAGTCAGAAT       c.1800
 I  N  A  Q  N  C  V  H  C  K  T  C  D  I  K  D  P  S  Q  N         p.600

          .         .         .         .         .                 g.41186
 ATTAACTGGGTGGTACCTGAAGGTGGAGGAGGACCTGCTTACAATGGAATGTAA             c.1854
 I  N  W  V  V  P  E  G  G  G  G  P  A  Y  N  G  M  X               p.617

          .         .         .         .         .         .       g.41246
 actgcagctagccagtttctttcaagtatggcaagctaacgttaaaatgtttagagatta       c.*60

          .         .         .         .         .         .       g.41306
 acagatttcagaatgtctttctgcatattactgaacagaatagtcacaaaatgattatca       c.*120

          .         .         .         .                           g.41349
 aataaaaattttatactatatgtaagattgtcccataaagaaa                        c.*163

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Electron-transferring-flavoprotein dehydrogenase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 35
©2004-2013 Leiden University Medical Center