desert hedgehog homolog (Drosophila) (DHH) - coding DNA reference sequence

(used for mutation description)

(last modified May 18, 2012)


This file was created to facilitate the description of sequence variants in the DHH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008973.1, covering DHH transcript NM_021044.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5007
                                                      gtccgga       c.-301

 .         .         .         .         .         .                g.5067
 gtccgggcgttctggcagcaccagagtcctgcagcagagacgggctgggctggcactcac       c.-241

 .         .         .         .         .         .                g.5127
 ccacgaccccccttccctgctatgatggtttgtcagtagcaggtcctagacaccccccgc       c.-181

 .         .         .         .         .         .                g.5187
 ccgctcccggggcacgtgggcagagctagcagcagccaggtgcacggagccacaagagct       c.-121

 .         .         .         .         .         .                g.5247
 ctagggcactctgggggcagctgtgcctgctgccctctctggtgcctgtggagatgccta       c.-61

 .         .         .         .         .         .                g.5307
 actgacaggagagttagtgaggacaagaacgctcccttttggccgaggtccgctgtatcc       c.-1

          .         .         .         .         .         .       g.5367
 ATGGCTCTCCTGACCAATCTACTGCCCCTGTGCTGCTTGGCACTTCTGGCGCTGCCAGCC       c.60
 M  A  L  L  T  N  L  L  P  L  C  C  L  A  L  L  A  L  P  A         p.20

          .         .         .         .         .         .       g.5427
 CAGAGCTGCGGGCCGGGCCGGGGGCCGGTTGGCCGGCGCCGCTATGCGCGCAAGCAGCTC       c.120
 Q  S  C  G  P  G  R  G  P  V  G  R  R  R  Y  A  R  K  Q  L         p.40

          .         .         .         .         .         .       g.5487
 GTGCCGCTACTCTACAAGCAATTTGTGCCCGGCGTGCCAGAGCGGACCCTGGGCGCCAGT       c.180
 V  P  L  L  Y  K  Q  F  V  P  G  V  P  E  R  T  L  G  A  S         p.60

          .         .         .         .         .         .       g.5547
 GGGCCAGCGGAGGGGAGGGTGGCAAGGGGCTCCGAGCGCTTCCGGGACCTCGTGCCCAAC       c.240
 G  P  A  E  G  R  V  A  R  G  S  E  R  F  R  D  L  V  P  N         p.80

          .         .         .         .         .         .       g.5607
 TACAACCCCGACATCATCTTCAAGGATGAGGAGAACAGTGGAGCCGACCGCCTGATGACC       c.300
 Y  N  P  D  I  I  F  K  D  E  E  N  S  G  A  D  R  L  M  T         p.100

     | 02    .         .         .         .         .         .    g.8487
 GAG | CGTTGTAAGGAGCGGGTGAACGCTTTGGCCATTGCCGTGATGAACATGTGGCCCGGA    c.360
 E   | R  C  K  E  R  V  N  A  L  A  I  A  V  M  N  M  W  P  G      p.120

          .         .         .         .         .         .       g.8547
 GTGCGCCTACGAGTGACTGAGGGCTGGGACGAGGACGGCCACCACGCTCAGGATTCACTC       c.420
 V  R  L  R  V  T  E  G  W  D  E  D  G  H  H  A  Q  D  S  L         p.140

          .         .         .         .         .         .       g.8607
 CACTACGAAGGCCGTGCTTTGGACATCACTACGTCTGACCGCGACCGCAACAAGTATGGG       c.480
 H  Y  E  G  R  A  L  D  I  T  T  S  D  R  D  R  N  K  Y  G         p.160

          .         .         .         .         .         .       g.8667
 TTGCTGGCGCGCCTCGCAGTGGAAGCCGGCTTCGACTGGGTCTACTACGAGTCCCGCAAC       c.540
 L  L  A  R  L  A  V  E  A  G  F  D  W  V  Y  Y  E  S  R  N         p.180

          .         .      | 03  .         .         .         .    g.9370
 CACGTCCACGTGTCGGTCAAAGCTG | ATAACTCACTGGCGGTCCGGGCGGGCGGCTGCTTT    c.600
 H  V  H  V  S  V  K  A  D |   N  S  L  A  V  R  A  G  G  C  F      p.200

          .         .         .         .         .         .       g.9430
 CCGGGAAATGCAACTGTGCGCCTGTGGAGCGGCGAGCGGAAAGGGCTGCGGGAACTGCAC       c.660
 P  G  N  A  T  V  R  L  W  S  G  E  R  K  G  L  R  E  L  H         p.220

          .         .         .         .         .         .       g.9490
 CGCGGAGACTGGGTTTTGGCGGCCGATGCGTCAGGCCGGGTGGTGCCCACGCCGGTGCTG       c.720
 R  G  D  W  V  L  A  A  D  A  S  G  R  V  V  P  T  P  V  L         p.240

          .         .         .         .         .         .       g.9550
 CTCTTCCTGGACCGGGACTTGCAGCGCCGGGCTTCATTTGTGGCTGTGGAGACCGAGTGG       c.780
 L  F  L  D  R  D  L  Q  R  R  A  S  F  V  A  V  E  T  E  W         p.260

          .         .         .         .         .         .       g.9610
 CCTCCACGCAAACTGTTGCTCACGCCCTGGCACCTGGTGTTTGCCGCTCGAGGGCCGGCG       c.840
 P  P  R  K  L  L  L  T  P  W  H  L  V  F  A  A  R  G  P  A         p.280

          .         .         .         .         .         .       g.9670
 CCCGCGCCAGGCGACTTTGCACCGGTGTTCGCGCGCCGGCTACGCGCTGGGGACTCGGTG       c.900
 P  A  P  G  D  F  A  P  V  F  A  R  R  L  R  A  G  D  S  V         p.300

          .         .         .         .         .         .       g.9730
 CTGGCGCCCGGCGGGGATGCGCTTCGGCCAGCGCGCGTGGCCCGTGTGGCGCGGGAGGAA       c.960
 L  A  P  G  G  D  A  L  R  P  A  R  V  A  R  V  A  R  E  E         p.320

          .         .         .         .         .         .       g.9790
 GCCGTGGGCGTGTTCGCGCCGCTCACCGCGCACGGGACGCTGCTGGTGAACGATGTCCTG       c.1020
 A  V  G  V  F  A  P  L  T  A  H  G  T  L  L  V  N  D  V  L         p.340

          .         .         .         .         .         .       g.9850
 GCCTCTTGCTACGCGGTTCTGGAGAGTCACCAGTGGGCGCACCGCGCTTTTGCCCCCTTG       c.1080
 A  S  C  Y  A  V  L  E  S  H  Q  W  A  H  R  A  F  A  P  L         p.360

          .         .         .         .         .         .       g.9910
 AGACTGCTGCACGCGCTAGGGGCGCTGCTCCCCGGCGGGGCCGTCCAGCCGACTGGCATG       c.1140
 R  L  L  H  A  L  G  A  L  L  P  G  G  A  V  Q  P  T  G  M         p.380

          .         .         .         .         .                 g.9961
 CATTGGTACTCTCGGCTCCTCTACCGCTTAGCGGAGGAGCTACTGGGCTGA                c.1191
 H  W  Y  S  R  L  L  Y  R  L  A  E  E  L  L  G  X                  p.396

          .         .         .         .         .         .       g.10021
 gcgtcccaggcatagaaacctcgaagcgcccgaggaaacgagggcctgctggctgagata       c.*60

          .         .         .         .         .         .       g.10081
 tggggctgtgggcagcagacgatgccgactggaagggagggagagggagggggagggaga       c.*120

          .         .         .         .         .         .       g.10141
 aaatggggctatgcctggcttaggggcaacctcgtactgagaggaggtgataccgggtcc       c.*180

          .         .         .         .         .         .       g.10201
 taggtaggtagggctgatggtgcgcactccttaaagaggactatttagcctctcccccag       c.*240

          .         .         .         .         .         .       g.10261
 tgcttcagccccacccgataattttattttatttcttatttataaattgtaatataatga       c.*300

          .         .         .         .         .         .       g.10321
 ttcccttgcccagcttgccaaggtgaggggctggggcatggcattaacactgtctgacac       c.*360

          .         .         .         .         .         .       g.10381
 agccagccagtctgacatctgacgttttcctgcaaggtgggctaataaagggaaggcttt       c.*420

          .                                                         g.10399
 caggagcttactggaaaa                                                 c.*438

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Desert hedgehog homolog (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center