cystatin B (stefin B) (CSTB) - coding DNA reference sequence

(used for mutation description)

(last modified June 18, 2012)


This file was created to facilitate the description of sequence variants in the CSTB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011545.1, covering CSTB transcript NM_000100.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5049
               cttggttccgcccgcgcgtcacgtgaccccagcgcctacttgggct       c.-61

 .         .         .         .         .         .                g.5109
 gaggagccgccgcgtcccctcgccgagtcccctcgccagattccctccgtcgccgccaag       c.-1

          .         .         .         .         .         .       g.5169
 ATGATGTGCGGGGCGCCCTCCGCCACGCAGCCGGCCACCGCCGAGACCCAGCACATCGCC       c.60
 M  M  C  G  A  P  S  A  T  Q  P  A  T  A  E  T  Q  H  I  A         p.20

        | 02 .         .         .         .         .         .    g.6673
 GACCAG | GTGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCC    c.120
 D  Q   | V  R  S  Q  L  E  E  K  E  N  K  K  F  P  V  F  K  A      p.40

          .         .         .         .         | 03         .    g.7060
 GTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAG | GTGCACGTCGGC    c.180
 V  S  F  K  S  Q  V  V  A  G  T  N  Y  F  I  K   | V  H  V  G      p.60

          .         .         .         .         .         .       g.7120
 GACGAGGACTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTG       c.240
 D  E  D  F  V  H  L  R  V  F  Q  S  L  P  H  E  N  K  P  L         p.80

          .         .         .         .         .                 g.7177
 ACCTTATCTAACTACCAGACCAACAAAGCCAAGCATGATGAGCTGACCTATTTCTGA          c.297
 T  L  S  N  Y  Q  T  N  K  A  K  H  D  E  L  T  Y  F  X            p.98

          .         .         .         .         .         .       g.7237
 tcctgactttggacaaggcccttcagccagaagactgacaaagtcatcctccgtctacca       c.*60

          .         .         .         .         .         .       g.7297
 gagcgtgcacttgtgatcctaaaataagcttcatctccgggctgtgccccttggggtgga       c.*120

          .         .         .         .         .         .       g.7357
 aggggcaggattctgcagctgcttttgcatttctcttcctaaatttcattgtgttgattt       c.*180

          .         .         .         .         .         .       g.7417
 ctttccttcccaataggtgatcttaattactttcagaatattttcaaaatagatatattt       c.*240

          .         .         .         .         .         .       g.7477
 ttaaaatccttacagattgcctcctttgttttagacttttttcttcgtctgaaccacccc       c.*300

          .         .         .         .         .         .       g.7537
 gggcaggtccttcccctcgggggcatggagggcggagagactgcctggctcacacagcaa       c.*360

          .         .         .         .         .         .       g.7597
 gcaggtggtggacccaggattcacacctgcccactccggcccgcgttcctaaccaccact       c.*420

          .         .         .         .         .         .       g.7657
 ctttacatgttggtgctttgactcttaggtcctggccccaagcttcagtttctcccataa       c.*480

          .         .         .         .         .                 g.7714
 aataaaagagtgtgagtaaatccaattccagagcataactggctccagatctcagat          c.*537

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Cystatin B (stefin B) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center