autoimmune regulator (AIRE) - coding DNA reference sequence

(used for mutation description)

(last modified January 23, 2012)


This file was created to facilitate the description of sequence variants in the AIRE gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009556.1, covering AIRE transcript NM_000383.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5007
                                                      agacggg       c.-121

 .         .         .         .         .         .                g.5067
 cgggcgcacagccggcgcggaggccccacagccccgccgggacccgaggccaagcgaggg       c.-61

 .         .         .         .         .         .                g.5127
 gctgccagtgtcccgggacccaccgcgtccgccccagccccgggtccccgcgcccacccc       c.-1

          .         .         .         .         .         .       g.5187
 ATGGCGACGGACGCGGCGCTACGCCGGCTTCTGAGGCTGCACCGCACGGAGATCGCGGTG       c.60
 M  A  T  D  A  A  L  R  R  L  L  R  L  H  R  T  E  I  A  V         p.20

          .         .         .         .         .         .       g.5247
 GCCGTGGACAGCGCCTTCCCACTGCTGCACGCGCTGGCTGACCACGACGTGGTCCCCGAG       c.120
 A  V  D  S  A  F  P  L  L  H  A  L  A  D  H  D  V  V  P  E         p.40

          .   | 02     .         .         .         .         .    g.5725
 GACAAGTTTCAG | GAGACGCTTCATCTGAAGGAAAAGGAGGGCTGCCCCCAGGCCTTCCAC    c.180
 D  K  F  Q   | E  T  L  H  L  K  E  K  E  G  C  P  Q  A  F  H      p.60

          .         .         .         .         .         .       g.5785
 GCCCTCCTGTCCTGGCTGCTGACCCAGGACTCCACAGCCATCCTGGACTTCTGGAGGGTG       c.240
 A  L  L  S  W  L  L  T  Q  D  S  T  A  I  L  D  F  W  R  V         p.80

          .         .         .         .         .         .       g.5845
 CTGTTCAAGGACTACAACCTGGAGCGCTATGGCCGGCTGCAGCCCATCCTGGACAGCTTC       c.300
 L  F  K  D  Y  N  L  E  R  Y  G  R  L  Q  P  I  L  D  S  F         p.100

         | 03.         .         .         .         .         .    g.6151
 CCCAAAG | ATGTGGACCTCAGCCAGCCCCGGAAGGGGAGGAAGCCCCCGGCCGTCCCCAAG    c.360
 P  K  D |   V  D  L  S  Q  P  R  K  G  R  K  P  P  A  V  P  K      p.120

          .         .         .         .         .         .       g.6211
 GCTTTGGTACCGCCACCCAGACTCCCCACCAAGAGGAAGGCCTCAGAAGAGGCTCGAGCT       c.420
 A  L  V  P  P  P  R  L  P  T  K  R  K  A  S  E  E  A  R  A         p.140

          .         .         .         .    | 04    .         .    g.6654
 GCCGCGCCAGCAGCCCTGACTCCAAGGGGCACCGCCAGCCCAG | GCTCTCAACTGAAGGCC    c.480
 A  A  P  A  A  L  T  P  R  G  T  A  S  P  G |   S  Q  L  K  A      p.160

          .         .         .         .         .         | 05    g.7467
 AAGCCCCCCAAGAAGCCGGAGAGCAGCGCAGAGCAGCAGCGCCTTCCACTCGGGAACG | GG    c.540
 K  P  P  K  K  P  E  S  S  A  E  Q  Q  R  L  P  L  G  N  G |       p.180

          .         .         .         .         .         .       g.7527
 ATTCAGACCATGTCAGCTTCAGTCCAGAGAGCTGTGGCCATGTCCTCCGGGGACGTCCCG       c.600
 I  Q  T  M  S  A  S  V  Q  R  A  V  A  M  S  S  G  D  V  P         p.200

          .         .         .         .         .   | 06     .    g.8785
 GGAGCCCGAGGGGCCGTGGAGGGGATCCTCATCCAGCAGGTGTTTGAGTCAG | GCGGCTCC    c.660
 G  A  R  G  A  V  E  G  I  L  I  Q  Q  V  F  E  S  G |   G  S      p.220

          .         .         .         .         .         .       g.8845
 AAGAAGTGCATCCAGGTTGGCGGGGAGTTCTACACTCCCAGCAAGTTCGAAGACTCCGGC       c.720
 K  K  C  I  Q  V  G  G  E  F  Y  T  P  S  K  F  E  D  S  G         p.240

          .         .         .         .         .         .       g.8905
 AGTGGGAAGAACAAGGCCCGCAGCAGCAGTGGCCCGAAGCCTCTGGTTCGAGCCAAGGGA       c.780
 S  G  K  N  K  A  R  S  S  S  G  P  K  P  L  V  R  A  K  G         p.260

          .         | 07         .         .         .         .    g.9150
 GCCCAGGGCGCTGCCCCC | GGTGGAGGTGAGGCTAGGCTGGGCCAGCAGGGCAGCGTTCCC    c.840
 A  Q  G  A  A  P   | G  G  G  E  A  R  L  G  Q  Q  G  S  V  P      p.280

          .         .         .          | 08        .         .    g.10236
 GCCCCTCTGGCCCTCCCCAGTGACCCCCAGCTCCACCAG | AAGAATGAGGACGAGTGTGCC    c.900
 A  P  L  A  L  P  S  D  P  Q  L  H  Q   | K  N  E  D  E  C  A      p.300

          .         .         .         .         .         .       g.10296
 GTGTGTCGGGACGGCGGGGAGCTCATCTGCTGTGACGGCTGCCCTCGGGCCTTCCACCTG       c.960
 V  C  R  D  G  G  E  L  I  C  C  D  G  C  P  R  A  F  H  L         p.320

          .         .         .      | 09  .         .         .    g.11447
 GCCTGCCTGTCCCCTCCGCTCCGGGAGATCCCCAG | TGGGACCTGGAGGTGCTCCAGCTGC    c.1020
 A  C  L  S  P  P  L  R  E  I  P  S  |  G  T  W  R  C  S  S  C      p.340

          .         .         .         .         .         .       g.11507
 CTGCAGGCAACAGTCCAGGAGGTGCAGCCCCGGGCAGAGGAGCCCCGGCCCCAGGAGCCA       c.1080
 L  Q  A  T  V  Q  E  V  Q  P  R  A  E  E  P  R  P  Q  E  P         p.360

          .      | 10  .         .         .         .         .    g.12158
 CCCGTGGAGACCCCG | CTCCCCCCGGGGCTTAGGTCGGCGGGAGAGGAGGTAAGAGGTCCA    c.1140
 P  V  E  T  P   | L  P  P  G  L  R  S  A  G  E  E  V  R  G  P      p.380

          .         .         .         .         .         .       g.12218
 CCTGGGGAACCCCTAGCCGGCATGGACACGACTCTTGTCTACAAGCACCTGCCGGCTCCG       c.1200
 P  G  E  P  L  A  G  M  D  T  T  L  V  Y  K  H  L  P  A  P         p.400

          .         .         .         .         .         .       g.12278
 CCTTCTGCAGCCCCGCTGCCAGGGCTGGACTCCTCGGCCCTGCACCCCCTACTGTGTGTG       c.1260
 P  S  A  A  P  L  P  G  L  D  S  S  A  L  H  P  L  L  C  V         p.420

          .         | 11         .         .         .         .    g.12951
 GGTCCTGAGGGTCAGCAG | AACCTGGCTCCTGGTGCGCGTTGCGGGGTGTGCGGAGATGGT    c.1320
 G  P  E  G  Q  Q   | N  L  A  P  G  A  R  C  G  V  C  G  D  G      p.440

          .         .         .         .         .         .       g.13011
 ACGGACGTGCTGCGGTGTACTCACTGCGCCGCTGCCTTCCACTGGCGCTGCCACTTCCCA       c.1380
 T  D  V  L  R  C  T  H  C  A  A  A  F  H  W  R  C  H  F  P         p.460

          .         . | 12       .         .         .         .    g.13561
 GCCGGCACCTCCCGGCCCGG | GACGGGCCTGCGCTGCAGATCCTGCTCAGGAGACGTGACC    c.1440
 A  G  T  S  R  P  G  |  T  G  L  R  C  R  S  C  S  G  D  V  T      p.480

          .         .         .         .         .         .       g.13621
 CCAGCCCCTGTGGAGGGGGTGCTGGCCCCCAGCCCCGCCCGCCTGGCCCCTGGGCCTGCC       c.1500
 P  A  P  V  E  G  V  L  A  P  S  P  A  R  L  A  P  G  P  A         p.500

     | 13    .         .         .         .         .         .    g.15560
 AAG | GATGACACTGCCAGTCACGAGCCCGCTCTGCACAGGGATGACCTGGAGTCCCTTCTG    c.1560
 K   | D  D  T  A  S  H  E  P  A  L  H  R  D  D  L  E  S  L  L      p.520

        | 14 .         .         .         .         .         .    g.16830
 AGCGAG | CACACCTTCGATGGCATCCTGCAGTGGGCCATCCAGAGCATGGCCCGTCCGGCG    c.1620
 S  E   | H  T  F  D  G  I  L  Q  W  A  I  Q  S  M  A  R  P  A      p.540

          .                                                         g.16848
 GCCCCCTTCCCCTCCTGA                                                 c.1638
 A  P  F  P  S  X                                                   p.545

          .         .         .         .         .         .       g.16908
 ccccagatggccgggacatgcagctctgatgagagagtgctgagaaggacacctccttcc       c.*60

          .         .         .         .         .         .       g.16968
 tcagtcctggaagccggccggctgggatcaagaaggggacagcgccacctcttgtcagtg       c.*120

          .         .         .         .         .         .       g.17028
 ctcggctgtaaacagctctgtgtttctggggacaccagccatcatgtgcctggaaattaa       c.*180

          .         .         .         .         .         .       g.17088
 accctgccccacttctctactctggaagtccccgggagcctctccttgcctggtgaccta       c.*240

          .         .         .         .         .         .       g.17148
 ctaaaaatataaaaattagctgggtgtggtggtgggtgcctgtaatcccagctacatggg       c.*300

          .         .         .         .         .         .       g.17208
 agcctgaggcatgagaatcacttgaactcgggaggtggaggttgcagtgagctgagattg       c.*360

          .         .         .         .         .         .       g.17268
 cgccactgcactccagtctggtcggcaagagtgagactccgtctcaaaaacaaaacaaaa       c.*420

          .         .         .         .         .         .       g.17328
 caaaaaaaccacataacataaatttatcatctcgaccacttttcagttcagtggcattca       c.*480

          .                                                         g.17340
 catctcatgtaa                                                       c.*492

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Autoimmune regulator protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center