Retinaldehyde binding protein 1 (RLBP1) - 661 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.7015
gtctgagtactgatccctggctattttttggctgtgttaccttggacaagtcacttattc  c.-101+60

         .         .         .         .         .         .  g.7075
ctcctcccgtttcctcctatgtaaaatggaaataataatgttgaccctgggtctgagaga  c.-101+120

         .         .         .         .         .         .  g.7135
gtggatttgaaagtacttagtgcatcacaaagcacagaacacacttccagtctcgtgatt  c.-101+180

         .         .         .         .         .         .  g.7195
atgtacttatgtaactggtcatcacccatcttgagaatgaatgcattggggaaagggcca  c.-101+240

         .         .         .         .         .         .  g.7255
tccactaggctgcgaagtttctgagggactccttcgggctggagaaggatggccacagga  c.-101+300

         .         .         .   g.7286
gggaggagagattgccttatcctgcagtgat  c.-101+331

--------------------- middle of intron ---------------------
                  g.7287      .         .         .           g.7316
                  c.-100-330  catgtcattgagaacagagccagattcttt  c.-100-301

.         .         .         .         .         .           g.7376
ttttcctggcagggccaacttgttttaacatctaaggactgagctatttgtgtctgtgcc  c.-100-241

.         .         .         .         .         .           g.7436
ctttgtccaagcagtgtttcccaaagtgtagcccaagaaccatctccctcagagccacca  c.-100-181

.         .         .         .         .         .           g.7496
ggaagtgctttaaattgcaggttcctaggccacagcctgcacctgcagagtcagaatcat  c.-100-121

.         .         .         .         .         .           g.7556
ggaggttgggacccaggcacctgcgtttctaacaaatgcctcgggtgattctgatgcaat  c.-100-61

.         .         .         .         .         .           g.7616
tgaaagtttgagatccacagttctgagacaataacagaatggtttttctaacccctgcag  c.-100-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center