Retinaldehyde binding protein 1 (RLBP1) - coding DNA reference sequence

(used for mutation description)

(last modified January 7, 2012)


This file was created to facilitate the description of sequence variants in the RLBP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008116.1, covering RLBP1 transcript NM_000326.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5020
                                         gagcccgatttaacggaaac       c.-361

 .         .         .         .         .         .                g.5080
 tgtgggcggtgagaagttccttatgacacactaatcccaacctgctgaccggaccacgcc       c.-301

 .         .         .         .         .         .                g.5140
 tccagcggagggaacctctagagctccaggacattcaggtaccaggtagccccaaggagg       c.-241

 .         .       | 02 .         .         .         .             g.6875
 agctgccgacctggcag | ggaacaaccaagactggggttaaatctcacagcctgcaagtgg    c.-181

 .         .         .         .         .         .                g.6935
 aagagaagaacttgaacccaggtccaacttttgcgccacagcaggctgcctcttggtcct       c.-121

 .         .          | 03        .         .         .             g.7656
 gacaggaagtcacaacttgg | ccctgacttcctatcctagggaaggggccggctggagagg    c.-61

 .         .         .         .         .         .                g.7716
 ccaggacagagaaagcagatcccttctttttccaaggactctgtgtcttccataggcaac       c.-1

          .   | 04     .         .         .         .         .    g.8046
 ATGTCAGAAGGG | GTGGGCACGTTCCGCATGGTACCTGAAGAGGAACAGGAGCTCCGTGCC    c.60
 M  S  E  G   | V  G  T  F  R  M  V  P  E  E  E  Q  E  L  R  A      p.20

          .         .         .         .         .         .       g.8106
 CAACTGGAGCAGCTCACAACCAAGGACCATGGACCTGTCTTTGGCCCGTGCAGCCAGCTG       c.120
 Q  L  E  Q  L  T  T  K  D  H  G  P  V  F  G  P  C  S  Q  L         p.40

          .         .  | 05      .         .         .         .    g.9406
 CCCCGCCACACCTTGCAGAAG | GCCAAGGATGAGCTGAACGAGAGAGAGGAGACCCGGGAG    c.180
 P  R  H  T  L  Q  K   | A  K  D  E  L  N  E  R  E  E  T  R  E      p.60

          .         .         .         .         .         .       g.9466
 GAGGCAGTGCGAGAGCTGCAGGAGATGGTGCAGGCGCAGGCGGCCTCGGGGGAGGAGCTG       c.240
 E  A  V  R  E  L  Q  E  M  V  Q  A  Q  A  A  S  G  E  E  L         p.80

          .         .         .         .         .         .       g.9526
 GCGGTGGCCGTGGCGGAGAGGGTGCAAGAGAAGGACAGCGGCTTCTTCCTGCGCTTCATC       c.300
 A  V  A  V  A  E  R  V  Q  E  K  D  S  G  F  F  L  R  F  I         p.100

          .         .         .         .       | 06 .         .    g.11467
 CGCGCACGGAAGTTCAACGTGGGCCGTGCCTATGAGCTGCTCAGAG | GCTATGTGAATTTC    c.360
 R  A  R  K  F  N  V  G  R  A  Y  E  L  L  R  G |   Y  V  N  F      p.120

          .         .         .         .         .         .       g.11527
 CGGCTGCAGTACCCTGAGCTCTTTGACAGCCTGTCCCCAGAGGCTGTCCGCTGCACCATT       c.420
 R  L  Q  Y  P  E  L  F  D  S  L  S  P  E  A  V  R  C  T  I         p.140

          .         .         .         .         .         .       g.11587
 GAAGCTGGCTACCCTGGTGTCCTCTCTAGTCGGGACAAGTATGGCCGAGTGGTCATGCTC       c.480
 E  A  G  Y  P  G  V  L  S  S  R  D  K  Y  G  R  V  V  M  L         p.160

          .         .         .         .      | 07  .         .    g.14805
 TTCAACATTGAGAACTGGCAAAGTCAAGAAATCACCTTTGATGAG | ATCTTGCAGGCATAT    c.540
 F  N  I  E  N  W  Q  S  Q  E  I  T  F  D  E   | I  L  Q  A  Y      p.180

          .         .         .         .         .         .       g.14865
 TGCTTCATCCTGGAGAAGCTGCTGGAGAATGAGGAAACTCAAATCAATGGCTTCTGCATC       c.600
 C  F  I  L  E  K  L  L  E  N  E  E  T  Q  I  N  G  F  C  I         p.200

          .         .         .         .         .         .       g.14925
 ATTGAGAACTTCAAGGGCTTTACCATGCAGCAGGCTGCTAGTCTCCGGACTTCAGATCTC       c.660
 I  E  N  F  K  G  F  T  M  Q  Q  A  A  S  L  R  T  S  D  L         p.220

          .         .     | 08   .         .         .         .    g.15918
 AGGAAGATGGTGGACATGCTCCAG | GATTCCTTCCCAGCCCGGTTCAAAGCCATCCACTTC    c.720
 R  K  M  V  D  M  L  Q   | D  S  F  P  A  R  F  K  A  I  H  F      p.240

          .         .         .         .         .         .       g.15978
 ATCCACCAGCCATGGTACTTCACCACGACCTACAATGTGGTCAAGCCCTTCTTGAAGAGC       c.780
 I  H  Q  P  W  Y  F  T  T  T  Y  N  V  V  K  P  F  L  K  S         p.260

          .      | 09  .         .         .         .         .    g.16293
 AAGCTGCTTGAGAGG | GTCTTTGTCCACGGGGATGACCTTTCTGGTTTCTACCAGGAGATC    c.840
 K  L  L  E  R   | V  F  V  H  G  D  D  L  S  G  F  Y  Q  E  I      p.280

          .         .         .         .         .         .       g.16353
 GATGAGAACATCCTGCCCTCTGACTTCGGGGGCACGCTGCCCAAGTATGATGGCAAGGCC       c.900
 D  E  N  I  L  P  S  D  F  G  G  T  L  P  K  Y  D  G  K  A         p.300

          .         .         .         .         .                 g.16407
 GTTGCTGAGCAGCTCTTTGGCCCCCAGGCCCAAGCTGAGAACACAGCCTTCTGA             c.954
 V  A  E  Q  L  F  G  P  Q  A  Q  A  E  N  T  A  F  X               p.317

          .         .         .         .         .         .       g.16467
 aaacatctcctgccagctgaactgtagttagaatctctgggcctctcctcaactgtcctg       c.*60

          .         .         .         .         .         .       g.16527
 gacccaaggctaggaaagggctgcttgagatgactgtggtccccccttagactccctaag       c.*120

          .         .         .         .         .         .       g.16587
 cccgagtgagctcaggtgtcaccctgttctcaagttgggggatgggtaataaaggagggg       c.*180

          .         .         .         .         .         .       g.16647
 gaattcccttgaacaagaagaactggggatagttatatttccacctgcccttgaagcttt       c.*240

          .         .         .         .         .         .       g.16707
 aagacagtgatttttgtgtaaggttgtatttcaaagactcgaattcattttctcagtcat       c.*300

          .         .         .         .         .         .       g.16767
 ttcctttgtaacagagttttacgacttagagtctgtgaaaacaggcaaggagcccgggtt       c.*360

          .         .         .         .         .                 g.16825
 aaaatatccccctattcgcccccaaaatgcaataaaagaagataaaagagagaggata         c.*418

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Retinaldehyde binding protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center