Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - 4365 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.32555
gtgtgtgaaggcaatgcggttctctccaccacctgtgtgcatgggaggtgccggactcgc  c.848+60

         .         .         .         .         .         .  g.32615
tgggctgttcatcctgagaagctgagtttgtgcctgatgatgcaatccaggtttgggttg  c.848+120

         .         .         .         .         .         .  g.32675
ggcctgcaaacagaatgccgttgctttgttaaggaaacttacagtacaaacttatgtgtt  c.848+180

         .         .         .         .         .         .  g.32735
gggaagagttgcttttctggctttattttatactcgtgtgccgcttttccatgaaaactt  c.848+240

         .         .         .         .         .         .  g.32795
tgcagctttctgaaagcttttaaagaagactgtcgctgttggttatgccatggagatctg  c.848+300

         .         .         .         .         .         .  g.32855
gatcgtttttctccttctttaagcttttggctcacttgattcatgaatttttaaatacca  c.848+360

         .         .         .         .         .         .  g.32915
attagcacaaagtgctaggggaacgtcctctctcttcggtgtgaactctgtccctcaatg  c.848+420

         .         .         .         .         .         .  g.32975
ctgccaagattggcactatctgttgaaatatagaagtagaaattttagtgctgaatctta  c.848+480

         .         .         .         .         .         .  g.33035
tcatgaactcaatgagcaactagagtctgggagtaaagggaagcccagggtgaaatctct  c.848+540

         .         .         .         .         .         .  g.33095
ttcccattccatgacagaatccagccctgtctgctctgttgtcccgctttgttcaaggct  c.848+600

         .         .         .         .         .         .  g.33155
tttcatcagtgcagtatttattccgtgaagcactggaaatagtcttagtgtctgatgaga  c.848+660

         .         .         .         .         .         .  g.33215
ggggaatggataagtgataatagctaatgttgcttgagtttttataatgtgtttggtact  c.848+720

         .         .         .         .         .         .  g.33275
cagttctgagtgtgtaatgtgtattaattcatataatcatcacaaccctgcgaggcaggt  c.848+780

         .         .         .         .         .         .  g.33335
aatattaccccaagttttcacatgaaactgaggcgcaagataattaagaaacttgctcaa  c.848+840

         .         .         .         .         .         .  g.33395
agtcatatagcttataagtggtagatctgggatttacgccctggcaatctggctctagag  c.848+900

         .         .         .         .         .         .  g.33455
ctgtgccattcagtatggtagccactagccacatgttgctattgagcacttgaaatatgg  c.848+960

         .         .         .         .         .         .  g.33515
ctagtccagattgagatgcactgtaagtgtacagtgcataccagatttttgaagacatac  c.848+1020

         .         .         .         .         .         .  g.33575
aggttgagcatcacaaatctgaaaattcggagtccggaatatttcagtaagcatttcctt  c.848+1080

         .         .         .         .         .         .  g.33635
tgagttgcatgttgctgctaaaaatgttttggatttcagagtatttcgggttttagattt  c.848+1140

         .         .         .         .         .         .  g.33695
ttggggtttgagatgctcagctggtaagtacaatgcaaatatttcataattcaaataaat  c.848+1200

         .         .         .         .         .         .  g.33755
gtaaaatcctaaatacttctgatcccaagcatttttttttgagatggattttcactcttg  c.848+1260

         .         .         .         .         .         .  g.33815
tcactcaggctggagggcaatggcttgatcttggctcactgcaacttcagcctcctgggt  c.848+1320

         .         .         .         .         .         .  g.33875
tcaagcgattctcctgactcagcctcctgagtagctgggattacaggtgcccgccaccac  c.848+1380

         .         .         .         .         .         .  g.33935
acctgactagtttttgtatttttagtcgagatgggctttcaccatgttggccaggctggt  c.848+1440

         .         .         .         .         .         .  g.33995
cttgaactcctgacgtcagttgatccacctgccttggcctcctaaagtgctgggattaca  c.848+1500

         .         .         .         .         .         .  g.34055
ggcgtgagccaccgcgcccagccccaagcatttctgataagggatgctcaacctatagta  c.848+1560

         .         .         .         .         .         .  g.34115
taaaaaaagaagtgtaagttatctcattttatatttttaaatgagataaaagatatctca  c.848+1620

         .         .         .         .         .         .  g.34175
ttttttatattgattgcatgctaaaatgattttgctatttgtgggttaaataaagtacat  c.848+1680

         .         .         .         .         .         .  g.34235
atttattaactcaataaatgaatgtgtaattaaatgttactaaataaatttcaccaattt  c.848+1740

         .         .         .         .         .         .  g.34295
ctttttacattttaaatgtagctgctagaaaattcaaaatgacatatgtggctcacaatt  c.848+1800

         .         .         .         .         .         .  g.34355
gtgtttctcatcatatttctttctttcttttttttttttttttttttttttggagacata  c.848+1860

         .         .         .         .         .         .  g.34415
gtctcactctgttgcccaggctggagtgcaatggcatgatcttggctcactgcaacctcc  c.848+1920

         .         .         .         .         .         .  g.34475
acctcctgggttcaagggatcctcctgcctcagcctcccgagtagctgggattacaggtg  c.848+1980

         .         .         .         .         .         .  g.34535
catgccacgacgcccagctagtttttgtatttctagtagagatggagttttgccatgttg  c.848+2040

         .         .         .         .         .         .  g.34595
accaggctggtcttgaactcctgacctcaagtgatccgcccacctcagcctcccaaagtg  c.848+2100

         .         .         .         .         .         .  g.34655
ctgggattgcaggcgtgagccactgcgcctggtcttcccatcatatttctattggacagt  c.848+2160

         .         .     g.34678
tgctactctagagtctgagtgtt  c.848+2183

--------------------- middle of intron ---------------------
                          g.34679       .         .           g.34700
                          c.849-2182  taacattgctgccttaaatatg  c.849-2161

.         .         .         .         .         .           g.34760
taataaaatatacagtcattaaatatcatattttaatataatatgtaattaatataaaaa  c.849-2101

.         .         .         .         .         .           g.34820
tgttagtgatataatgttgtaaggaaaaaactggaatacaaaactatatgattttttata  c.849-2041

.         .         .         .         .         .           g.34880
catagagaacagtctggagggataaccagccactgggcagtagtggttacttccagggag  c.849-1981

.         .         .         .         .         .           g.34940
ttttagggagagccaagcagagtgtgaaggatgatttttatctttttattctaggtgttt  c.849-1921

.         .         .         .         .         .           g.35000
ttttattatttaaaaattttgccaggtgcagtggctcatgcatgtaatcccagcactttg  c.849-1861

.         .         .         .         .         .           g.35060
ggaggctgaggtgggtggatcacttgaggtcaggagttgagaccagcctggccaacgtgg  c.849-1801

.         .         .         .         .         .           g.35120
tgtaaccccatctctactaaaaatacaaaaaattagctgatcatgttggtgggtgcctgt  c.849-1741

.         .         .         .         .         .           g.35180
aatcccagccactcaggaggctgaggcaggagaatcacttgaacctgggaggcggaggct  c.849-1681

.         .         .         .         .         .           g.35240
gcagtaagccgagatcactccactgcactccagcctgggcgacagaatgagactctgtct  c.849-1621

.         .         .         .         .         .           g.35300
caaaaaaaaaaaaaaaaaaaaaaatttaaggctgggtgtggcggctcatgcctgtagtcc  c.849-1561

.         .         .         .         .         .           g.35360
cagtactttgggaggccaaggcaggaggattgcttgagctcgggaattccataccagcct  c.849-1501

.         .         .         .         .         .           g.35420
ggacaacaaagtgagacccccatctctactaaaaatcaaaaaattagcccagcattgtgg  c.849-1441

.         .         .         .         .         .           g.35480
tgcatgcctgtagtcccagctactcgggaggctaaggtgggaggatggcttcagcctggg  c.849-1381

.         .         .         .         .         .           g.35540
aggtcaaggctgcatgatagtgccactgcactccagcctgggtgatgaagtgagacccta  c.849-1321

.         .         .         .         .         .           g.35600
tctcaaaaaaaaaaaaaaaatcctcctcaaactagatacagtatgatcccggttttatgt  c.849-1261

.         .         .         .         .         .           g.35660
aagagagaaagagagagagagactatatctctatttatatccaaacaaagcaaaaaaaaa  c.849-1201

.         .         .         .         .         .           g.35720
aaaaagactgtacagaaagcaactaaatgatagacttttcttttttttgagacggagttt  c.849-1141

.         .         .         .         .         .           g.35780
cggtcttgtcgcccaggctggatttcagtggcgtgatctccactcactgcaacctctgcc  c.849-1081

.         .         .         .         .         .           g.35840
tcctgggttcaagccattctcctgcatcagcctcccaagtagctgggattacgggtgccc  c.849-1021

.         .         .         .         .         .           g.35900
accaccacacccggctaattgttttttgtatttttagtagaggcagggtttcgccttgtt  c.849-961

.         .         .         .         .         .           g.35960
ggccaggctgctcttgaactcctgacctcaggtgatccacccacctcagcctcccaaagt  c.849-901

.         .         .         .         .         .           g.36020
cctgggattacaggtgtgagccaccgtgcccagccgtgataggcttttcttcttttatca  c.849-841

.         .         .         .         .         .           g.36080
gcactgcatgttccgaatgttttacaggacttttataattagaaaaaaggaacattaaaa  c.849-781

.         .         .         .         .         .           g.36140
acaaaaaacatggggggagcggggagggatagcattaggagatatacctaatgctaaatg  c.849-721

.         .         .         .         .         .           g.36200
acgagttcatgggtgcagcacaccaacatggcacatgtatacatatgtaacaaacctgca  c.849-661

.         .         .         .         .         .           g.36260
cgttgtgcacatgtaccctaaaacttaaagtataataataataaaattaaaaaaaacaaa  c.849-601

.         .         .         .         .         .           g.36320
aaaaaacatgatgagaactgtgttctgctcccaccccctatccctctagtcctcagggcc  c.849-541

.         .         .         .         .         .           g.36380
cctgctcattccaaagcaaatctggagggcttggtctggggttcatggtatgcaagtgca  c.849-481

.         .         .         .         .         .           g.36440
tctgtccccagaattcaagaggcctgtgaacttggatgggaaaataacttcatctttaat  c.849-421

.         .         .         .         .         .           g.36500
ttaacctccaactgagatttggcattttcttcaattacgaatgtaggcactgaactgtag  c.849-361

.         .         .         .         .         .           g.36560
tagtagtagtgatacctgtgactttgtcaccaatagaattataaatatttttatatcaca  c.849-301

.         .         .         .         .         .           g.36620
ttgcagttgttgcagatatcctagaatgtcacttctgctcgccactactttgaaatcctt  c.849-241

.         .         .         .         .         .           g.36680
tgattattagacctggtactagatcttgttatagaatatattaataaataagcctgtgta  c.849-181

.         .         .         .         .         .           g.36740
ttactatatcacaaatttgtttttaaaatatttttggagtgcattttgtataattagttt  c.849-121

.         .         .         .         .         .           g.36800
ctttgagtctggcatatattgtattttattcatttagaaacattctgagaaagggaccat  c.849-61

.         .         .         .         .         .           g.36860
aaagatttccagactgctaattctcattcctggaatttactgtctttctctgccctccag  c.849-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center