Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - 825 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.29330
gtaagtatctttgggtgactaaaaaatgaggtacacccactatcttttctttaggaagat  c.448+60

         .         .         .         .         .         .  g.29390
gacactgtgtaaatgtggagaatgtccaggggccttcatagagcctaggaattccaatag  c.448+120

         .         .         .         .         .         .  g.29450
actagacccattggcttgttgttcactgtacctctcctgatcagtctaaaaaagtgagat  c.448+180

         .         .         .         .         .         .  g.29510
cttcctacccataccattaagaagccccaaatttcaggaaataccagggagaagaatgtc  c.448+240

         .         .         .         .         .         .  g.29570
attcttggatggggcagtggcagtacaaggcttgccaggcagggccagacctggggttat  c.448+300

         .         .         .         .         .         .  g.29630
gcaggcatctgggcttggctggaggggtcacatctacatgatggccaaccaagccatggg  c.448+360

         .         .         .         .         .     g.29683
ttggtccacggaggtaggcaatccttgagaacttgagtacgaggcagggtggg  c.448+413

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.29735
        gttcagcgttcaaggcaaagactttagggaggagagcatggagcatgttttc  c.449-361

.         .         .         .         .         .           g.29795
tgatcctaagcaaatgttatcttccctgactgttctatccttctgcctatacacaagtgt  c.449-301

.         .         .         .         .         .           g.29855
acctgggtccctagttatgcgatcatggccagagtgggagttggaagccagcaggtgggt  c.449-241

.         .         .         .         .         .           g.29915
caagggcagaggtacaaagtaatataattaagtatgattgccttacttgtagtctagctc  c.449-181

.         .         .         .         .         .           g.29975
tggctcttgctttgaggaatccacaaactcagaccaaactgaccattagagttactcatg  c.449-121

.         .         .         .         .         .           g.30035
gcatcaaaattggttcacacccagaagatagtgagctaacactgaagtcctcttggctcc  c.449-61

.         .         .         .         .         .           g.30095
cacatgctgagcctgggctgtcattccactttcaatcttccctgctggctctcctcacag  c.449-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center