Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - 796 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.28429
gtgaggtcctgatgggtaggtagaaaagcaggaaattgggtatgggagtggctgctccac  c.343+60

         .         .         .         .         .         .  g.28489
cctagaccatctatggcccttacatcagaaccatcatccaccccactagacaggttctgc  c.343+120

         .         .         .         .         .         .  g.28549
cacatgaaccagcaggacagggaattggcaagaggatggtgggtagatagactgggcagg  c.343+180

         .         .         .         .         .         .  g.28609
atccttatcatcttttcgcctcagcaatgggaatgtcggaggtgttagctccctgtctgg  c.343+240

         .         .         .         .         .         .  g.28669
gcttgcaccttggcatcaaggtgtggccacaatgccactctcttctttcatcctgagaat  c.343+300

         .         .         .         .         .         .  g.28729
caaccttgtgtggccataggcatgagatgaagttgtgctgctggcaagttcttctggatc  c.343+360

         .         .         .          g.28767
ttggaaaatgaccagcttctaccacggactatgaaatc  c.343+398

--------------------- middle of intron ---------------------
           g.28768            .         .         .           g.28805
           c.344-398  catgagggacatcctgggaccatgtctggcttgtgtta  c.344-361

.         .         .         .         .         .           g.28865
ccactggattcctagtgcccagcagagtgcacctggctcagagtcggtagttagtacaca  c.344-301

.         .         .         .         .         .           g.28925
tttgctgaataaatgaatgaacaatgtccaggaagatatgagtaactaaaattactcatt  c.344-241

.         .         .         .         .         .           g.28985
agaaacccagtgacaatgcttattggatgtcactgagataggtccaaatgaaggatagtt  c.344-181

.         .         .         .         .         .           g.29045
attgagtgctgaggcaataccttgttttaaaaggaaggggcagagcaagtgactcctatc  c.344-121

.         .         .         .         .         .           g.29105
aaaatgttaccccaacaaagacaactaatgaacaaagggaaagggcaattatgcaggtct  c.344-61

.         .         .         .         .         .           g.29165
gttacaggcagctaggggactccttgctaaccataggatctctttggttgtgccctatag  c.344-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center