Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - 507 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.27766
gtaagtgtttcccctttagtctccaaagggccatgcctcccacccttcttcccactgggg  c.187+60

         .         .         .         .         .         .  g.27826
cctctgtccatattgctttgtgtttcctcctaggcttgggggctctgactagaaattcaa  c.187+120

         .         .         .         .         .         .  g.27886
ggaacctgggattcaagtccaactgtgacaccaacttacactgtggcctccaataaactg  c.187+180

         .         .         .         .         .         .  g.27946
cttctttcctattccctctctattaaataaaataaggaaaacgatgtctgtgtatagcca  c.187+240

         .      g.27960
agtcagttattcta  c.187+254

--------------------- middle of intron ---------------------
                                    g.27961       .           g.27973
                                    c.188-253  aaaggagatacta  c.188-241

.         .         .         .         .         .           g.28033
agtgacattaaatatcagaatgtaaaacctgggaaccaggttcccagcctgggattaaac  c.188-181

.         .         .         .         .         .           g.28093
tgacagcaagaagactgaacagtactactgtgaaaagcccgaagtggcaatatgttcact  c.188-121

.         .         .         .         .         .           g.28153
ctaccgttgaaggatggctgggagaatgaatgctctgtcccccagtcccaagctcactta  c.188-61

.         .         .         .         .         .           g.28213
ctatacctcctttatagcctaggatatgaacatactgctctttttttgtcttggacccag  c.188-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center