Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - 1762 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.25885
gtttgtcttaattcagcaactcaaacaatcgtttacaaagacctgcactggaagccggtt  c.68+60

         .         .         .         .         .         .  g.25945
ctcagctgctgaaagaagagaaagggaaggaggctgacagaggagaaagtcagggcagga  c.68+120

         .         .         .         .         .         .  g.26005
aaagcaggaaggaagggggtgttgtggataccatggtggaaaaccagaaggaagcatctg  c.68+180

         .         .         .         .         .         .  g.26065
cggccgggcagaggtggggctgagttctggccccacctgagctctggggagagttctact  c.68+240

         .         .         .         .         .         .  g.26125
gccagcggaaggctgcatggatgactctgtcaagtagctcaacaaacaccttaggtggga  c.68+300

         .         .         .         .         .         .  g.26185
gtccttgcgttttcattttattcctttgggtgtctctgaagaactcggagactctgtccc  c.68+360

         .         .         .         .         .         .  g.26245
tattcagggtggccctgctggcttgtcatgctgttaagtaccaggtagtttgggaaagaa  c.68+420

         .         .         .         .         .         .  g.26305
acaaactcttctgcctttgagactaccctcaattaatgttttgggatggcttttttgctg  c.68+480

         .         .         .         .         .         .  g.26365
tgggatttctagaggtgtcaaataaaagtgtgttctgagtggagaatttttaaatttctc  c.68+540

         .         .         .         .         .         .  g.26425
ttttttaatttttgctctgtcaccccagggtggagtgcattggtgtagtcataggtcact  c.68+600

         .         .         .         .         .         .  g.26485
gcagccttgaactcttgggctcaagcaaccctcctgcctcagcctcccaagtagttggga  c.68+660

         .         .         .         .         .         .  g.26545
atataggcaggtgccactacacccagctactttttaaattttttgtggagatgggggtct  c.68+720

         .         .         .         .         .         .  g.26605
cactatgttgcccaggctggtctcaaactcctgggcttaagcgaccatcccacgttggcc  c.68+780

         .         .         .         .         .         .  g.26665
tcccaagatgttgggattacaggcatgagccactgggctcagcctaaaaaatttcttatg  c.68+840

         .         .         .         .   g.26706
ataaaggaggttaaatggacctaccaaggacagtgttattc  c.68+881

--------------------- middle of intron ---------------------
         g.26707    .         .         .         .           g.26747
         c.69-881  taggttctccatagagatctgggttcaagtcccacttctgc  c.69-841

.         .         .         .         .         .           g.26807
caccactatgtgacatgaacctccctgagcctcagttttctctactgtaatgtggaaata  c.69-781

.         .         .         .         .         .           g.26867
atactggagaagttgagaggattaaaataaattacatatggaaagtgcctagactagtaa  c.69-721

.         .         .         .         .         .           g.26927
ttggcagtcagatgatgtgcaggaaatgttagttctgcccctccgtattctgttttagga  c.69-661

.         .         .         .         .         .           g.26987
cctgtgaagtcaacttcatgtaaaagagtgctctctgcacagaggtctgaacaaaggagg  c.69-601

.         .         .         .         .         .           g.27047
ttttctctctgtttgccatcggccagaatgaaatctctaatacaatggctgaaagcctcg  c.69-541

.         .         .         .         .         .           g.27107
gaaatgacccactccctaaaactggagaggcagcctaagatcagtacctgtgtatgccat  c.69-481

.         .         .         .         .         .           g.27167
cccccagagtgctaagagcagtacctgtgtgtgccaccccccacagagtgctgttcatca  c.69-421

.         .         .         .         .         .           g.27227
gttactcatgatgatggttactgaatattgactccgctaatgtttatcatgcatatgttt  c.69-361

.         .         .         .         .         .           g.27287
tgaatgtaggttagaggggaaagctttcctctggaacctctagagataagagctagatgt  c.69-301

.         .         .         .         .         .           g.27347
atttattatctaacaaggaaagtctccattggccctgactccagcatttactctgtttgc  c.69-241

.         .         .         .         .         .           g.27407
taatatgattatttgtggcttctgggcaagtgatcttcccacctgcaccgataaacaggc  c.69-181

.         .         .         .         .         .           g.27467
gactaccttgccccatggaaaaatgttgtcctatgaaggttagcttttatgagtctcctg  c.69-121

.         .         .         .         .         .           g.27527
actgcaacttaaagatacccttctttgaggctggatagagtttttttttttttttttaac  c.69-61

.         .         .         .         .         .           g.27587
gtatcttagtgtgagctcgtgaaggatggtacgtgatgctcttgtttcccttgccgatag  c.69-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center