Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - 1521 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.24077
gtgagtaccatcttcttaaatgcaaggatcttagatttgagtcaagaagtgtctgctggg  c.-220+60

         .         .         .         .         .         .  g.24137
aatgatctgatcactccttgttctgttggtcaggtccatgggtttccccaggggcagaaa  c.-220+120

         .         .         .         .         .         .  g.24197
ctgtgtcttcctagtatgttgcacaattcctggtgcagagaaacactcagtaaatgtgtg  c.-220+180

         .         .         .         .         .         .  g.24257
ttgaggatgaactgatgaatgaggacatgaacacctgcctgccacagaagtctttcatgc  c.-220+240

         .         .         .         .         .         .  g.24317
atgggtgttcctggaggctcctctggcttcacaggaagggacagaactgggaaattattc  c.-220+300

         .         .         .         .         .         .  g.24377
ctggggtcctgtcccagctccttgtctattcttctgtccaagagaggaacacagagcgag  c.-220+360

         .         .         .         .         .         .  g.24437
gaagggcaatgaatcccacttacccttctcccatctcacacacatccagaggcacgatcc  c.-220+420

         .         .         .         .         .         .  g.24497
tagctcacttcaaccttgacctctgagctcaagtgatcctccctactcagcctcccgagt  c.-220+480

         .         .         .         .         .         .  g.24557
agctaggattacaggcacgcaccaccacacccagataattttttgtagagacagggtctc  c.-220+540

         .         .         .         .         .         .  g.24617
actaagttgcctaagctcagtcttgaacttctggcctcaagggatccccctaccttgggc  c.-220+600

         .         .         .         .         .         .  g.24677
tctttaccagcattttcttgtatttctcctcatcttcaatagcattcaactgaaacatca  c.-220+660

         .         .         .         .         .         .  g.24737
cccacgttcatcatctctcccttttctacaccatggccttgagtaaagcaagtgagatag  c.-220+720

         .         .         .         .   g.24778
caagggagatacgaatcagaacagctaaccataacagctga  c.-220+761

--------------------- middle of intron ---------------------
        g.24779     .         .         .         .           g.24818
        c.-219-760  ctcttatatactgtttagcatatgccagtttcgttttcca  c.-219-721

.         .         .         .         .         .           g.24878
ccaatgtaataattgaacacttagaacaagtggggatatatatatatatatatatatata  c.-219-661

.         .         .         .         .         .           g.24938
tgtataacacatatatatataaaaccatatattatatatataatcatacccattgtacaa  c.-219-601

.         .         .         .         .         .           g.24998
gtgagaaaactgagttaacagagaggtttagtaacttgcccagggccgtggagcttttaa  c.-219-541

.         .         .         .         .         .           g.25058
atagattcagcgctagagtccatgcacttaaacaccatacctttccttgtaatatgcatg  c.-219-481

.         .         .         .         .         .           g.25118
tgcgtgtgttaacttcattgaagtaaaatataaaatgcagaaaagtgcacaagtcgaaag  c.-219-421

.         .         .         .         .         .           g.25178
catacgactcagcagattttcataaagtgagcacacccatgtactagcacccagatgaaa  c.-219-361

.         .         .         .         .         .           g.25238
gagcagagcactctcagccctccaggagttccagtcatctccctccccagtcactgcccc  c.-219-301

.         .         .         .         .         .           g.25298
ctcctccctaaggttaactgctcttctgacgtctctctccattcttctgggagtttcctt  c.-219-241

.         .         .         .         .         .           g.25358
cccatcctattttaatccactcatattttaagcatcatggggtttgtggctaaagttaga  c.-219-181

.         .         .         .         .         .           g.25418
aatattctatatattccatcttgcagtagaggtggcagtggttgggagaacacatttcct  c.-219-121

.         .         .         .         .         .           g.25478
agagaagagaaacaattgaggatggggggtttagggggtacttgctttagtttccccaca  c.-219-61

.         .         .         .         .         .           g.25538
ttctctttgccagtaaacctaagtaagcttcaaaccttgactccatcccctccccaccag  c.-219-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center