Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - downstream reference sequence


            .         .         .         .         .         . g.37623
tca / ttgtcttatttattttctcagggcagcaagggagagaaatggaacaaatcaggaaac c.*660

         .         .         .         .         .         .    g.37683
cagcctgctagtttagtgagtagcatttcaccctacccagccacgggaattgggaatagc    c.*720

         .         .         .         .         .         .    g.37743
aagggagcaggcctaggcctagaactcagggcaaagacagcagctggaatgtaagatcct    c.*780

         .         .         .         .         .         .    g.37803
cagagtgtgtagctgctgggaggaatccatctgagttaggcagacagagaaaaagcagtt    c.*840

         .         .         .         .         .         .    g.37863
tcagtgagaatctggcacccaaaaggaaaggattttactcccccatggcctaactgcctt    c.*900

         .         .         .         .         .         .    g.37923
aggaaatttgagtgctgacggagacactcttccccttgagttttaggaaaggggtgctat    c.*960

         .         .         .         .         .         .    g.37983
tctctgcgttatccccatctccttccttcctgaaggaggctccacttgcagaatgcatca    c.*1020

         .         .         .         .         .         .    g.38043
tttcctgccgccctcagcaaggatcacagcttggccagctcacagtggtacagggctggg    c.*1080

         .         .         .         .         .         .    g.38103
agtggatactcctaactgcaatgctgtactgcctctcatttaaagacattttgttaaata    c.*1140

         .         .         .         .         .         .    g.38163
tctggctagagaaaatattttaaatctgaaagtttccatcatatcccagattattagatg    c.*1200

         .         .         .         .         .         .    g.38223
cacttacaaccaacagcaaatgacaccaaatatcgggaagctgagcagcaaagaatgcaa    c.*1260

         .         .         .         .         .         .    g.38283
aagaaaacaatgataggcatgggtgttgattcgacatgttgttggcattttcagaatatt    c.*1320

         .         .         .         .         .         .    g.38343
aagccacagtcgttccccttgttcagattccagactccatcatttctcgtggtgttcagg    c.*1380

         .         .         .         .         .         .    g.38403
tgctcccacgagacacagcctccctcagcactactccttcagaatcgcctcgtgctcagg    c.*1440

         .         .         .         .         .         .    g.38463
ctacatctcacctctctgtagtgtctcgcccgacaccaaaaggaccatctagtctgctca    c.*1500

         .         .         .         .         .         .    g.38523
gcctgggcaaggaacatgtgccagtcttggcctcttgtcatgtttccagaaaagacttgc    c.*1560

         .         .         .         .         .         .    g.38583
cgcaagttaacatctgagcaagtgaaaggccttggctctgcacaaacaatgccgggggat    c.*1620

         .         .         .         .         .         .    g.38643
tggtggccgagacaccgttcgaccttcccatcttggctccctgaaatcccctgcaacctt    c.*1680

         .         .         .         .         .         .    g.38703
cggggctgtttttccgctattgacttgtgcttggatatggatatggcttcctgccttggc    c.*1740

         .         .         .         .         .         .    g.38763
agagtgcccctcaacatacaggaaacaagatcctggatgagaagggctcagggatttcag    c.*1800

         .         .         .         .         .         .    g.38823
ttgttccagacttccctcctaggtgcttctctaactgccccagttccactgccttcacta    c.*1860

         .         .         .         .         .         .    g.38883
ttcctggcttctcttagcctctgacacccttagctaatctagcctggggtggaaaatctt    c.*1920

         .         .         .         .         .         .    g.38943
tttcttttggctcagctgagactgtcctaatttcctaaaaataacacttcaatgggaaac    c.*1980

         .         .         .         .         .         .    g.39003
taaaggaaaaggaaatcaaagagacatatgaaactcaagaaacaaacagtttcagagcac    c.*2040

         .         .         .         .         .         .    g.39063
cgatttcctaggtggtgactagctgccacagattaccttgggtggcacttggcccttgtc    c.*2100

         .         .         .         .         .         .    g.39123
caactcaacttcgtatacaatgttgccatgcgtcccaagctcaggaggatataccttgtg    c.*2160

         .         .         .         .         .         .    g.39183
tatttggtctcttttagttataagatggacactcagtttgagcaagcttaagtcccaaac    c.*2220

         .         .         .         .         .         .    g.39243
catgcaatattttgctcataaactcaaggaagggttgaaactggaaagtgggaatgggca    c.*2280

         .         .         .         .         .         .    g.39303
gagatgtatcttagaaataactagaactcaagcgccaagcaacaccagactcctctccct    c.*2340

         .         .         .         .         .         .    g.39363
ctaccattgaagagttcctgcagccatttcctatttttagaatttaaaaaattccaggtt    c.*2400

         .         .         .         .         .         .    g.39423
tggcttgggtcaaatgctcactgtgaagcattcaactgtagttgggtattgggtattgaa    c.*2460

         .         .         .         .         .         .    g.39483
acgtctcttctacggctatcatattctcatatatgctattttgatatcgctatcatattt    c.*2520

         .         .         .         .         .         .    g.39543
tcatattgtagaagaggcatttcaaatcagtcagaaaaacatagacaatgtcataagtgg    c.*2580

         .         .                                            g.39566
tgctggacaaataactatccaaa                                         c.*2603


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center