Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) (RDH12) - coding DNA reference sequence

(used for mutation description)

(last modified January 3, 2012)


This file was created to facilitate the description of sequence variants in the RDH12 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008321.1, covering RDH12 transcript NM_152443.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5024
                                     gggcacaagcaatcctcccttctc       c.-301

 .         .         .      | 02  .         .         .             g.23996
 agcttcctgagtggccaggactacag | aggactgtatgctgttcttaaggactctctgctt    c.-241

 .         .         . | 03       .         .         .             g.25577
 cctggacaagctcaagctaag | gactacatctcccagcaggctgtgctctgacagctcttg    c.-181

 .         .         .         .         .         .                g.25637
 gatttaaataggattctgggctctgctcagagtcaggctgctgctcagcacccaggacgg       c.-121

 .         .         .         .         .         .                g.25697
 agaggagcagagaagcagcagaagcagccaagagctggagccagaccaggaacctgagcc       c.-61

 .         .         .         .         .         .                g.25757
 agagctggggttgaagctggagcagcagcaaaagcaacagcagctacagaagttggaacg       c.-1

          .         .         .         .         .         .       g.25817
 ATGCTGGTCACCTTGGGACTGCTCACCTCCTTCTTCTCGTTCCTGTATATGGTAGCTCCA       c.60
 M  L  V  T  L  G  L  L  T  S  F  F  S  F  L  Y  M  V  A  P         p.20

          | 04         .         .         .         .         .    g.27639
 TCCATCAG | GAAGTTCTTTGCTGGTGGAGTGTGTAGAACAAATGTGCAGCTTCCTGGCAAG    c.120
 S  I  R  |  K  F  F  A  G  G  V  C  R  T  N  V  Q  L  P  G  K      p.40

          .         .         .         .         .         .       g.27699
 GTAGTGGTGATCACTGGCGCCAACACGGGCATTGGCAAGGAGACGGCCAGAGAGCTCGCT       c.180
 V  V  V  I  T  G  A  N  T  G  I  G  K  E  T  A  R  E  L  A         p.60

         | 05.         .         .         .         .         .    g.28266
 AGCCGAG | GAGCCCGAGTCTATATTGCCTGCAGAGATGTACTGAAGGGGGAGTCTGCTGCC    c.240
 S  R  G |   A  R  V  Y  I  A  C  R  D  V  L  K  G  E  S  A  A      p.80

          .         .         .         .         .         .       g.28326
 AGTGAAATCCGAGTGGATACAAAGAACTCCCAGGTGCTGGTGCGGAAATTGGACCTATCC       c.300
 S  E  I  R  V  D  T  K  N  S  Q  V  L  V  R  K  L  D  L  S         p.100

          .         .         .         .    | 06    .         .    g.29182
 GACACCAAATCTATCCGAGCCTTTGCTGAGGGCTTTCTGGCAG | AGGAAAAGCAGCTCCAT    c.360
 D  T  K  S  I  R  A  F  A  E  G  F  L  A  E |   E  K  Q  L  H      p.120

          .         .         .         .         .         .       g.29242
 ATTCTGATCAACAATGCGGGAGTAATGATGTGTCCATATTCCAAGACAGCTGATGGCTTT       c.420
 I  L  I  N  N  A  G  V  M  M  C  P  Y  S  K  T  A  D  G  F         p.140

          .         .         | 07         .         .         .    g.30127
 GAAACCCACCTGGGAGTCAACCACCTGG | GCCACTTCCTCCTCACCTACCTGCTCCTGGAG    c.480
 E  T  H  L  G  V  N  H  L  G |   H  F  L  L  T  Y  L  L  L  E      p.160

          .         .         .         .         .         .       g.30187
 CGGCTAAAGGTGTCTGCCCCTGCACGGGTGGTTAATGTGTCCTCGGTGGCTCACCACATT       c.540
 R  L  K  V  S  A  P  A  R  V  V  N  V  S  S  V  A  H  H  I         p.180

          .         .         .         .         .         .       g.30247
 GGCAAGATTCCCTTCCACGACCTCCAGAGCGAGAAGCGCTACAGCAGGGGTTTTGCCTAT       c.600
 G  K  I  P  F  H  D  L  Q  S  E  K  R  Y  S  R  G  F  A  Y         p.200

          .         .         .         .         .         | 08    g.32307
 TGCCACAGCAAGCTGGCCAATGTGCTTTTTACTCGTGAGCTGGCCAAGAGGCTCCAAG | GC    c.660
 C  H  S  K  L  A  N  V  L  F  T  R  E  L  A  K  R  L  Q  G |       p.220

          .         .         .         .         .         .       g.32367
 ACCGGGGTCACCACCTACGCAGTGCACCCAGGCGTCGTCCGCTCTGAGCTGGTCCGGCAC       c.720
 T  G  V  T  T  Y  A  V  H  P  G  V  V  R  S  E  L  V  R  H         p.240

          .         .         .         .         .         .       g.32427
 TCCTCCCTGCTCTGCCTGCTCTGGCGGCTCTTCTCCCCCTTTGTCAAGACGGCACGGGAG       c.780
 S  S  L  L  C  L  L  W  R  L  F  S  P  F  V  K  T  A  R  E         p.260

          .         .         .         .         .         .       g.32487
 GGGGCGCAGACCAGCCTGCACTGCGCCCTGGCTGAGGGCCTGGAGCCCCTGAGTGGCAAG       c.840
 G  A  Q  T  S  L  H  C  A  L  A  E  G  L  E  P  L  S  G  K         p.280

          | 09         .         .         .         .         .    g.36912
 TACTTCAG | TGACTGCAAGAGGACCTGGGTGTCTCCAAGGGCCCGAAATAACAAAACAGCT    c.900
 Y  F  S  |  D  C  K  R  T  W  V  S  P  R  A  R  N  N  K  T  A      p.300

          .         .         .         .         .                 g.36963
 GAGCGCCTATGGAATGTCAGCTGTGAGCTTCTAGGAATCCGGTGGGAGTAG                c.951
 E  R  L  W  N  V  S  C  E  L  L  G  I  R  W  E  X                  p.316

          .         .         .         .         .         .       g.37023
 ctggtggaagagctgcagctttatcaggcccaatccatgccataatgaacagggaccaag       c.*60

          .         .         .         .         .         .       g.37083
 gagaaggccaaccctaaaggattgtcctcttggccagctggtgctgcgaatcctgcctgc       c.*120

          .         .         .         .         .         .       g.37143
 tctgatcctcttgacccttctgggaatgtttgcacacctgacactcttgtgagactggct       c.*180

          .         .         .         .         .         .       g.37203
 tatggcatgagttgtggacacctatagagtgttcttctctaagacctggaaagtcagcaa       c.*240

          .         .         .         .         .         .       g.37263
 ccctctgggggcagcaggactgggcagatcccaggctgggcatgggggtggcagaagagc       c.*300

          .         .         .         .         .         .       g.37323
 ccgagaaattgggtcagttccctcatcagcaccagaggctcagctgaggcaagaagagca       c.*360

          .         .         .         .         .         .       g.37383
 ccatcactgcctatttctaggggctatacactccaactcttggttgatctctttcttttt       c.*420

          .         .         .         .         .         .       g.37443
 aaaaatatttgccaccaccctggagtctagaccaacacacaaagatcctggctaaccctg       c.*480

          .         .         .         .         .         .       g.37503
 gcctatttagattccttcctctcacctggaccttcccatttcaatcatgcagatggtttc       c.*540

          .         .         .         .         .         .       g.37563
 tttttgtaaagagttccgtttgcctttcaatttttagagaaaataaagactgcattcatc       c.*600

                                                                    g.37566
 tca                                                                c.*603

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Retinol dehydrogenase 12 (all-trans/9-cis/11-cis) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center