Crystallin, gamma-D (CRYGD) - upstream reference sequence


                                    g.1           .             g.16
                                    c.-5116 ccatccgggtggagag    c.-5101

.         .         .         .         .         .             g.76
cggctgctggatgctctatgagcgtcccaactaccaaggtcaacaatacttgctgcggcg    c.-5041

.         .         .         .         .         .             g.136
aggggagtaccccgactaccagcaatggatgggcctcagcgactccatccgctcctgttg    c.-4981

.         .         .         .         .         .             g.196
tctcatcccccaagtgagttttctagatttccatcatgccgccagagtccccactgtatt    c.-4921

.         .         .         .         .         .             g.256
gtcaatgtgggttacagggagggaggtttgcatttaaaaacacctaagggttagatggac    c.-4861

.         .         .         .         .         .             g.316
atcagagacctgaataagccagatagataacatgcacaaaaacagcagagaatgtaagga    c.-4801

.         .         .         .         .         .             g.376
agaacccacttagaggaagaatccgttttacttgaaatttttgctaccaataagtcaatt    c.-4741

.         .         .         .         .         .             g.436
aaaagaggtctgtaacaaatgtaatatcataatgggatataaaacaaaacttgcaaatgg    c.-4681

.         .         .         .         .         .             g.496
gaagctggttgggcataaaaagacggtatttttaacaaattattttgtctatagtaaaag    c.-4621

.         .         .         .         .         .             g.556
aatttctaatgaatgaattagatagattccaccatggactagtaaaccttcaaagctgta    c.-4561

.         .         .         .         .         .             g.616
ttgttaatataggctattcaaaggttgtgtccaactttggaaaaggtaatttttcttaat    c.-4501

.         .         .         .         .         .             g.676
ttggaaaatcagttaaattctcattccaaatgactatttaactttacactgaagtacaag    c.-4441

.         .         .         .         .         .             g.736
attttttaaatcttactttagtggtaaatttatatgtttgtaaatttgggagataatacc    c.-4381

.         .         .         .         .         .             g.796
cttactaaaagaatactagtgaaaataaattatttctatttttccccccaaatgtagttt    c.-4321

.         .         .         .         .         .             g.856
gaattaacacaggtaattaggaatcaagatatctcagttcttgatggattctaactcaga    c.-4261

.         .         .         .         .         .             g.916
gtttgaacctcttaaaaattccatctcctaaataagaatgaatttcaggtcaaatagaaa    c.-4201

.         .         .         .         .         .             g.976
atgagcgtgccagtatttaggtgctagtggaagacagatccatgcgcagcaaccacagta    c.-4141

.         .         .         .         .         .             g.1036
atctacattttacactgtctaaattttacaatgacaattccatgccacaacctaccaagt    c.-4081

.         .         .         .         .         .             g.1096
tcatctgttctttggttggacaaattctggaagagactcatttgcttttttccatccttc    c.-4021

.         .         .         .         .         .             g.1156
tttctgtggaccgagtagacagtctcccacaggctgcggctgtacgagagggaagaccac    c.-3961

.         .         .         .         .         .             g.1216
aaaggcctcatgatggagctgagtgaagactgccccagcatccaggaccgcttccacctc    c.-3901

.         .         .         .         .         .             g.1276
agcgagatccgttccctccacgtgctggagggctgctgggtcctctacgagctgcccaac    c.-3841

.         .         .         .         .         .             g.1336
taccgggggcggcaatacctgctgaggccccaagagtacaggcggtgccaggactggggg    c.-3781

.         .         .         .         .         .             g.1396
gccatggatgctaaggcaggctctttgcggagagtggtggatttgtattaaaatagctta    c.-3721

.         .         .         .         .         .             g.1456
acactaccaatttcccattttggaacctaataaatatttagtctgcattgctggcaattg    c.-3661

.         .         .         .         .         .             g.1516
ctgacttctgtcattctttcattgtgcaaatcagttcacctttaaatgctccttgtcaaa    c.-3601

.         .         .         .         .         .             g.1576
agttaagaagtgaatggggtgggggacggggtctattggagaagagcttcaaggtagagt    c.-3541

.         .         .         .         .         .             g.1636
gagtttgaacaagcctcagacgttggggtggaggcagggtgtagcctgcccgagaaagaa    c.-3481

.         .         .         .         .         .             g.1696
aacgcagggcaatgccagagacctgggagaggctgactggtgagaagggaggcattcaac    c.-3421

.         .         .         .         .         .             g.1756
taagcaccttgaggaacaatagttgggaagtttccttctaaccaaaaatgggttagacaa    c.-3361

.         .         .         .         .         .             g.1816
aaggcaaagtcagatgagtggagagggcaaacttaacttggccaacagcctgattagact    c.-3301

.         .         .         .         .         .             g.1876
atataaaggattgtagttttgtttactttcagacacagtattatataactaatgccaggg    c.-3241

.         .         .         .         .         .             g.1936
ccaccgcagccattgccgtacctttgaacaaagttaaagactattcatcttcttttgaaa    c.-3181

.         .         .         .         .         .             g.1996
atgactcctgtccagaagtgtagctcttggtcggtactacccctggcccaaatgctgtgt    c.-3121

.         .         .         .         .         .             g.2056
caattatagaaactgcacatcagtttcatggtgaccagctattgcaaataaattaatatt    c.-3061

.         .         .         .         .         .             g.2116
aagagatacacatcaatcttttaaatagattttcatggtatagtgtaccccaaacataaa    c.-3001

.         .         .         .         .         .             g.2176
aaataactacaaaaaacatcgttctggcataaggacgcatgtatgcatatgtttatcaca    c.-2941

.         .         .         .         .         .             g.2236
gcactattcatgacagcaaagacatggaatcaacctaaatgcccatcaatggtaggctgg    c.-2881

.         .         .         .         .         .             g.2296
attttacaaagtggtacatatatacaatggaatactatgcagccataaaaaagaatgaga    c.-2821

.         .         .         .         .         .             g.2356
ccctgtcctttgcagcaacatagatggagctggaggccattatcctaagcaaactaacac    c.-2761

.         .         .         .         .         .             g.2416
aggaacagaaaacaaaatacctcatgttctcgcttctaagtgggagctaaactttgagta    c.-2701

.         .         .         .         .         .             g.2476
catgtggacaagaagaaaacaagagacactggggcctgcttgaggttgcagggtgggcgg    c.-2641

.         .         .         .         .         .             g.2536
ttggagaggatcaaaaaactacctgtcaggtactatacttatcacctgggtgataaaata    c.-2581

.         .         .         .         .         .             g.2596
atctgtacaccaaaccttcacaacatgcaatttacctgtattacaaacctggatacgtgc    c.-2521

.         .         .         .         .         .             g.2656
ccctaaatctaaaataaaagtttaaataaacaaatacgtaagtcctgtaattacaaaatg    c.-2461

.         .         .         .         .         .             g.2716
ggctcaaatttaaaggtgctttaaagaagccataatttctggagccttttattaaactaa    c.-2401

.         .         .         .         .         .             g.2776
aatctgcttgctcataagcaaagccctaaaaagtaaaaataaaaaaaaaaaaagaaagca    c.-2341

.         .         .         .         .         .             g.2836
attacgagtcttttcatcagcagagaatttatttattttaacttaaaaatttcccttcaa    c.-2281

.         .         .         .         .         .             g.2896
agtaaaaggcctcccataatcttactactgtacaaattctataaagaagttgaggggagt    c.-2221

.         .         .         .         .         .             g.2956
ccttctgacgcccctcattgctaactcttgtttatagttggtgggcacccttctgggatt    c.-2161

.         .         .         .         .         .             g.3016
ttctccttgtttatatagctctcttataaaacacatgcttcttttctttacaaaaatgga    c.-2101

.         .         .         .         .         .             g.3076
atcatgctatacatattagtctgcaacttgcttttaaaatgtattataatatggacatat    c.-2041

.         .         .         .         .         .             g.3136
atctaggtcagtatcttattctgtttgatggttgaattgcatcccattgtttggaggtcc    c.-1981

.         .         .         .         .         .             g.3196
cttagaccatttcaccatttgtccacttaagtgactgggcttttccaatgttgcttttac    c.-1921

.         .         .         .         .         .             g.3256
caacaatgctgcaaagaataacattgtacatatacgctaatcctgacatgccataatttt    c.-1861

.         .         .         .         .         .             g.3316
aaaaagatagcgacctagaagtgagactaccggctcatagtgcaagtttattttatttta    c.-1801

.         .         .         .         .         .             g.3376
tttatttattttttgagacatggtcacactctgttgtccaggatggagtgcagtggcaca    c.-1741

.         .         .         .         .         .             g.3436
aacccagctcactgcagcctcgacctcacaggctcaagcgatcctcccatctcagcctcc    c.-1681

.         .         .         .         .         .             g.3496
taagtagctggggctacaggcgcgcaccaccatgcctgactaattttttcacttttttgt    c.-1621

.         .         .         .         .         .             g.3556
agagaaggggtctcactatgttgccagggctggtctcgaactcctgggctcaagtgaccc    c.-1561

.         .         .         .         .         .             g.3616
tcccaccttggcctccgaaagtgctgggattacaggtgtgagccaccacacccagccaca    c.-1501

.         .         .         .         .         .             g.3676
agtttattttccatttcaatagcctccaattattagccactagagactcttaacttcctt    c.-1441

.         .         .         .         .         .             g.3736
gagttaggatccttaccaatttttgagcacctaccatacgcctgctatatgtagcaatgg    c.-1381

.         .         .         .         .         .             g.3796
ggatgaagaaaacaatcaaaacaaaacaaaagaaaaaggtatttccctaccaccgtagag    c.-1321

.         .         .         .         .         .             g.3856
ctctatatagaaagaatacaaaaaaaaaaaagcagccagaaaataagaattaaaataatt    c.-1261

.         .         .         .         .         .             g.3916
tgtattgcacatagttggtgtttaattcataaataccacttacaaagatttatgactcaa    c.-1201

.         .         .         .         .         .             g.3976
agacaagacaaagtacttccatgggttgacacagggctgtaagcaattctttgaacatga    c.-1141

.         .         .         .         .         .             g.4036
aagaagctggacacataggtcatattccactccagtactcttcccagtccatcaaactgc    c.-1081

.         .         .         .         .         .             g.4096
tctcttccaggccaataagtactttctgaagtcttcctcgagtccaacttctagattttt    c.-1021

.         .         .         .         .         .             g.4156
attccttcctctccctgcatcattccagccatagctcccctttgtgttcatgcaattaat    c.-961

.         .         .         .         .         .             g.4216
ttcgtctgagtcaaaggccttgtgtactctcgctcgttcagagggcaaaggtgtattcta    c.-901

.         .         .         .         .         .             g.4276
gatcctaccagaaataagtttcttaggaatttggttttattttataacaagctaagagat    c.-841

.         .         .         .         .         .             g.4336
catgtttttgtgtttcaaacatattactttttctaatttcctcaaacttagatatttccc    c.-781

.         .         .         .         .         .             g.4396
tttttagttctttctgagattaagcatcttagaactattctctcttttgaatcacggcac    c.-721

.         .         .         .         .         .             g.4456
cacctttagctaagagaaaaacatctaattctcagctacttccaggcataattgcaacaa    c.-661

.         .         .         .         .         .             g.4516
aatcagacccaatattgaagattcacgtttgctgtgtgttttaccataataaaagttcga    c.-601

.         .         .         .         .         .             g.4576
aattctgtgaactctcttaataaaatgttccaatttcttacaccctttcatgatgacgtt    c.-541

.         .         .         .         .         .             g.4636
ctcttaaaggactaacttgaaattttcaacattcagttaagcccatttccttcctattaa    c.-481

.         .         .         .         .         .             g.4696
caatcagtattcaatattgtggcacgtaagtaatactgtagttctgacagattaatttat    c.-421

.         .         .         .         .         .             g.4756
atttgccttattaagagtcgttgctttttttgctccccgacttaaattttttttgttttt    c.-361

.         .         .         .         .         .             g.4816
ccccaatctatacgaataaaagcgtgaactatatgtgaaatagctgaagctccacttcca    c.-301

.         .         .         .         .         .             g.4876
ttataaatagacaatgtcccaaattgccgttttacaaacattctcaatagcatcagccag    c.-241

.         .         .         .         .         .             g.4936
tgatagcaatccgaatactccagagagaatgcgaccaaaacccacaacaagccccgtggt    c.-181

.         .         .         .         .         .             g.4996
ctagcacagcaaagagaaaaaaagagaacacgaaaatgcccttgctcccctccgggggcc    c.-121

.            .         .         .         .         .          g.5056
cctt \ ttgtgcggttcttgccaacgcagcagccctcctgctatatagcccgccgcgccgca c.-61


Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center