Crystallin, gamma-D (CRYGD) - 2166 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5538
gtgagtacatcctcaagtcaggacccaggccctcaggacactcactggatggtttcaagc  c.252+60

         .         .         .         .         .         .  g.5598
aaaagttaaacattagaagtagtgatcagtcacaataactgagagtggacaaaagatgaa  c.252+120

         .         .         .         .         .         .  g.5658
ctatagtggattaagtcaatagagtttgctccccacataagcaaagtattacccagacac  c.252+180

         .         .         .         .         .         .  g.5718
cagttaatcacaattaatccacaaatatgtattgagtaggaatgtgtctcctgccctagg  c.252+240

         .         .         .         .         .         .  g.5778
ggttgtataagacttaagtcctattctggaatcatttagaatggagttgtagaaaaacca  c.252+300

         .         .         .         .         .         .  g.5838
ctaatacccaatagaagaataaatgctagagcgtacagcagttactgagcaaacagggta  c.252+360

         .         .         .         .         .         .  g.5898
atttcttttgagactttttcccgtttttgctcctctcttgcatattttgggttttcccaa  c.252+420

         .         .         .         .         .         .  g.5958
cctatataagtaagactttccttcaaaggagagcaacacacatattttacacatgtgtcc  c.252+480

         .         .         .         .         .         .  g.6018
cttttatcccatatgtgtgttagaacactaaagtttatgcaaaattcgtccttggactta  c.252+540

         .         .         .         .         .         .  g.6078
ctgatgtttcttcctccatttttcttcattgcattcacaagttattgacttagaattaat  c.252+600

         .         .         .         .         .         .  g.6138
tgttctttaatatatgaagatatttaacattttatattttaatatattttaaatatttat  c.252+660

         .         .         .         .         .         .  g.6198
attttaatatatttaaaacacttatattttgaatagaaggcttatatatttaacatattt  c.252+720

         .         .         .         .         .         .  g.6258
tatttatgtcattgatttaaatgatgcattatcatttaattcaatatattaaatgatata  c.252+780

         .         .         .         .         .         .  g.6318
tttaatatattttaaatacttatatttaaaatacatatttttatattttaaatatattta  c.252+840

         .         .         .         .         .         .  g.6378
cattaaatatatttaatgaatataatgtatttaataatatatttatttaataaatatgta  c.252+900

         .         .         .         .         .         .  g.6438
tttaatatatttatataactacataaattatattatattttaaatatatttaacatattt  c.252+960

         .         .         .         .         .         .  g.6498
taaatatattttaatatatttttaatatatttcatttacattatatgtgtgtatatatat  c.252+1020

         .         .         .         .         .         .  g.6558
atttttgttgttgttgttttgtttttgttttttgaaacagagtctcactctgacgcccag  c.252+1080

     g.6561
gct  c.252+1083

--------------------- middle of intron ---------------------
                                             g.6562           g.6564
                                             c.253-1083  gga  c.253-1081

.         .         .         .         .         .           g.6624
gtgcagtggtgcaatctcggctcactgcaacctccgcctcctggattcaaatgattctcg  c.253-1021

.         .         .         .         .         .           g.6684
tctctcagtctcctgagtagctggagttacaggagcacgccaccacacccagctaatttt  c.253-961

.         .         .         .         .         .           g.6744
tgtatttttatttttattttattttattttattatttattattattattttttttgacga  c.253-901

.         .         .         .         .         .           g.6804
agtcttgctctgttccccacgctggagtgcagtggcatgatctcggcacactgcaacctc  c.253-841

.         .         .         .         .         .           g.6864
tgcttcctgggccctagcaattttcttcccaagtagctgggattacaggcacccgccacc  c.253-781

.         .         .         .         .         .           g.6924
acacctggctaatttttgtatttttagtatagacaaggtttcgccatattcgtcaggctg  c.253-721

.         .         .         .         .         .           g.6984
gtcttgaactcctgacctcaagtgatccacctgcctcggcttcccagggtgctgggacta  c.253-661

.         .         .         .         .         .           g.7044
caggcatgagccactgccccaccccttatatttctgtattttaaatatattttatttata  c.253-601

.         .         .         .         .         .           g.7104
ttttagtaaagttattttaaaataaaatataatttgtaaaataaatataattttaattta  c.253-541

.         .         .         .         .         .           g.7164
tacttataaaatataatttgaatataattattaaaataaaatatgattaactttaaataa  c.253-481

.         .         .         .         .         .           g.7224
aatataattttatacattttataatatattttaaatatagtatataattaaatatgtatt  c.253-421

.         .         .         .         .         .           g.7284
agatatcatatgtatattaaaattatacattatttaaatatatttctttataatttaatg  c.253-361

.         .         .         .         .         .           g.7344
tttattttaatattaaaacatttcttcaaaatggtataaaatagtaataagctgttacag  c.253-301

.         .         .         .         .         .           g.7404
gtttggatttgcatgtggtacaggatactgagcctaggaggcagctcatcctaagaaata  c.253-241

.         .         .         .         .         .           g.7464
gctgaatatattaaagagtgagatttccttctcaatttcttcaccacacttcataatctt  c.253-181

.         .         .         .         .         .           g.7524
gaaaaggtactgaatctctgtgctcggtaatgaggagtttataaatattcagaattaatt  c.253-121

.         .         .         .         .         .           g.7584
aaattttaccatgtatttcaaaatggcttgagcgggtcctcaccaagctggactgcctaa  c.253-61

.         .         .         .         .         .           g.7644
caatgcattggaatcatttcacacttgcttttcttctctttttatttctgggtccgccag  c.253-1


Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center