Crystallin, gamma-D (CRYGD) - 110 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .       g.5180
gtgagcccagcctgcgccccgggaccccggagcttcctccatcgcgggggccaga  c.9+55

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.5235
     gactggggcaggagcaggcctgtgagacctcgccttgtcccgccttgccttgcag  c.10-1


Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center