Crystallin, gamma-D (CRYGD) - downstream reference sequence


            .         .         .         .         .         . g.8037
ctggca / ctgatttgcttgtgtctttctttactttgccctacttctatcttattttattta c.*120

         .         .         .         .         .         .    g.8097
cacacacgaggcaaatggcaaccaagatgtgtaatacatagataacaaaggaagttctca    c.*180

         .         .         .         .         .         .    g.8157
caacagaatgacgtcttcatattaagtagaacttaacagtttgcaaaagtttcataattc    c.*240

         .         .         .         .         .         .    g.8217
attatctcatttgattctctggcctttaaacagcttgctgcttcaaaccagattatcaga    c.*300

         .         .         .         .         .         .    g.8277
aatctgtttagatttcagtttttctttgaggagtgaggacctgaaaacgtaggttcagat    c.*360

         .         .         .         .         .         .    g.8337
agtgtgacccactttttcaatcagggattctgaacctgggtaccataacgcgcgtccatt    c.*420

         .         .         .         .         .         .    g.8397
tttgaattctctaaaattgtatgcaaaagttgagttcacaaatctctgtccgactccctt    c.*480

         .         .         .         .         .         .    g.8457
actacagaggtggtcatgtggccttcctctggccatcgaatcagaagtgagaaatgatga    c.*540

         .         .         .         .         .         .    g.8517
tagggagggagaagagatggttctggaaaaacttgtgcctttctaatgaaagagagcaga    c.*600

         .         .         .         .         .         .    g.8577
tgaccctgatgccaaagttccctcttatttcttacactcaagaaatgacagctgtgagag    c.*660

         .         .         .         .         .         .    g.8637
aaaggccaggagaatttcagaaatgttggcctagatgtggctgagcccctggaccatgct    c.*720

         .         .         .         .         .         .    g.8697
aacaaccttttaccttcagacttcttgtaatggcagtcaaataaaccacattttgtttaa    c.*780

         .         .         .         .         .         .    g.8757
gcccctatagctgggtattctgttatctgcagttcaacacacatttctagctgatgtaga    c.*840

         .         .         .         .         .         .    g.8817
gtatatgtgaattttccttaggtaactgtatagaattttatttagagacattcttaattt    c.*900

         .         .         .         .         .         .    g.8877
taaaattaaaaaaaaaaacaaagaaaaaagacgggagaacacacacgtggacacaaagaa    c.*960

         .         .         .         .         .         .    g.8937
gggaacaacagacactggacctgttggagggtggagggtgggaggagggagagaatcaga    c.*1020

         .         .         .         .         .         .    g.8997
agaaataactattggatactaggcctagtagctgggtgatgaaataacctgtacaacaaa    c.*1080

         .         .         .         .         .         .    g.9057
cccccgtgacacaagtttacctacatagcaaacatgcacatgtaccccgagcctaaaata    c.*1140

         .         .         .         .         .         .    g.9117
aaagttgaaaaaaaaaaaaggggaggagagaaaaagaaagaaagggaaggagggggagag    c.*1200

         .         .         .         .         .         .    g.9177
agaggcacagagaggggccattacagaacattgtagttataagataagatggttaatata    c.*1260

         .         .         .         .         .         .    g.9237
ttttaaatccgtagatcatctaacctagataactcattttatgtacagtaaactgaggtc    c.*1320

         .         .         .         .         .         .    g.9297
taattccaaggtcacaccaataacagaggtggaatcagaagccagaatcacagctcagaa    c.*1380

         .         .         .         .         .         .    g.9357
actgctggttttctattatgaaatcaggaagattttggccaggtgtggtggctcacacct    c.*1440

         .         .         .         .         .         .    g.9417
gtaatcccagcactttgggaggccgaggtgggcggatcaccttagatcaggagtttgaga    c.*1500

         .         .         .         .         .         .    g.9477
ccagcctgggcaacatggtaaaaccccgtctctactaaaaatacaaaaattagctgggcg    c.*1560

         .         .         .         .         .         .    g.9537
tggtggcaggtgcctgtaatcccagctacttaggaggctgaggcaggagaactgcttgag    c.*1620

         .         .         .         .         .         .    g.9597
ctcaggaggtggaggttgcagtgagctgagatcacaccactgcactccagtctgggcgac    c.*1680

         .         .         .         .         .         .    g.9657
agagcgagaccccgtctcaaaaaaaaaaaaaaaatcaggaagattttataaaatctattg    c.*1740

         .         .         .         .         .         .    g.9717
tgaaattttgtgaaagtaatgacaacactaaatcatagattcttaccatgaggtcgttgc    c.*1800

         .         .         .         .         .         .    g.9777
aaacaaccaaccaggaattgaattaaaaatattgaataatccaaagctgcattctctgaa    c.*1860

         .         .         .         .         .         .    g.9837
tacacatgggcacacacatacagttatatatatttatataacctcatccaatgtacgttt    c.*1920

         .         .         .         .         .         .    g.9897
gtgtgtgtcaatatactatgtataaggctgtcctacaatatattcacttacattggttct    c.*1980

         .         .         .         .         .         .    g.9957
tttcctacctcttattctgtcttatttgtactctcattgctagaattttagaaaggagga    c.*2040

         .         .                                            g.9983
gtcactatgtaagtgcttagaggcta                                      c.*2066


Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center