Crystallin, gamma-D (CRYGD) - coding DNA reference sequence

(used for mutation description)

(last modified March 14, 2010)


This file was created to facilitate the description of sequence variants in the CRYGD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008039.1, covering CRYGD transcript NM_006891.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5056
     ttgtgcggttcttgccaacgcagcagccctcctgctatatagcccgccgcgccgca       c.-61

 .         .         .         .         .         .                g.5116
 gccccacccgctcagcgccgccgccccaccagctcagcaccgccgtgcgcccagccagcc       c.-1

           | 02        .         .         .         .         .    g.5286
 ATGGGGAAG | ATCACCCTCTACGAGGACCGGGGCTTCCAGGGCCGCCACTATGAATGCAGC    c.60
 M  G  K   | I  T  L  Y  E  D  R  G  F  Q  G  R  H  Y  E  C  S      p.20

          .         .         .         .         .         .       g.5346
 AGCGACCACCCCAACCTGCAGCCCTACTTGAGCCGCTGCAACTCGGCGCGCGTGGACAGC       c.120
 S  D  H  P  N  L  Q  P  Y  L  S  R  C  N  S  A  R  V  D  S         p.40

          .         .         .         .         .         .       g.5406
 GGCTGCTGGATGCTCTATGAGCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCGC       c.180
 G  C  W  M  L  Y  E  Q  P  N  Y  S  G  L  Q  Y  F  L  R  R         p.60

          .         .         .         .         .         .       g.5466
 GGCGACTATGCCGACCACCAGCAGTGGATGGGCCTCAGCGACTCGGTCCGCTCCTGCCGC       c.240
 G  D  Y  A  D  H  Q  Q  W  M  G  L  S  D  S  V  R  S  C  R         p.80

          .   | 03     .         .         .         .         .    g.7692
 CTCATCCCCCAC | TCTGGCTCTCACAGGATCAGACTCTATGAGAGAGAGGACTACAGAGGC    c.300
 L  I  P  H   | S  G  S  H  R  I  R  L  Y  E  R  E  D  Y  R  G      p.100

          .         .         .         .         .         .       g.7752
 CAGATGATAGAGTTCACTGAGGACTGCTCCTGTCTTCAGGACCGCTTCCGCTTCAATGAA       c.360
 Q  M  I  E  F  T  E  D  C  S  C  L  Q  D  R  F  R  F  N  E         p.120

          .         .         .         .         .         .       g.7812
 ATCCACTCCCTCAACGTGCTGGAGGGCTCCTGGGTCCTCTACGAGCTGTCCAACTACCGA       c.420
 I  H  S  L  N  V  L  E  G  S  W  V  L  Y  E  L  S  N  Y  R         p.140

          .         .         .         .         .         .       g.7872
 GGACGGCAGTACCTGCTGATGCCAGGGGACTATAGGCGCTACCAGGACTGGGGGGCCACG       c.480
 G  R  Q  Y  L  L  M  P  G  D  Y  R  R  Y  Q  D  W  G  A  T         p.160

          .         .         .         .                           g.7917
 AATGCCAGAGTGGGCTCTCTGAGGAGAGTCATAGATTTCTCCTGA                      c.525
 N  A  R  V  G  S  L  R  R  V  I  D  F  S  X                        p.174

          .         .         .         .         .         .       g.7977
 aatatgtcctcttttgttgtttcttaatttggaaactaataaaatattttctgtgtgttc       c.*60

                                                                    g.7983
 ctggca                                                             c.*66

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, gamma-D protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center