Crystallin, beta-B2 (CRYBB2) - 2816 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.10452
gtaagtacctgggtggcctctcctggtcagggactttgggtgaggtgatcaagttgtgga  c.173+60

         .         .         .         .         .         .  g.10512
gtgggggaatctacccttgctcctgtctgcaaatctgggaaccaagttttggggtctggc  c.173+120

         .         .         .         .         .         .  g.10572
agcctatggagataattcatgctttgcagtcagatagagctgggttcaaatccaggttcc  c.173+180

         .         .         .         .         .         .  g.10632
accccttctgggttgtgtggtgttggaccaggaccttccccctctgagcctcagtttcct  c.173+240

         .         .         .         .         .         .  g.10692
cctctgtaggatgaggctaaccatgtactctggggatgaagggagagggtcatgtggaaa  c.173+300

         .         .         .         .         .         .  g.10752
gcctgatacagaggtcagccacttcctcaaggcaggaagatggacatagtgactgatgaa  c.173+360

         .         .         .         .         .         .  g.10812
gcttttagaactgccaatctctggctccaggagtgtcctcactcctgggaggtttaaggc  c.173+420

         .         .         .         .         .         .  g.10872
tggatgttccagccctgcatccactcctcccttcccgaatcctgacaatgctgggtcttt  c.173+480

         .         .         .         .         .         .  g.10932
acagattttttggcacacttgggggccaggtctctatccaagagagaaggggagctgaat  c.173+540

         .         .         .         .         .         .  g.10992
ggttggctcaccttatgtgatgtagctgagcatagtcctatgtgagcctgcagagtctgg  c.173+600

         .         .         .         .         .         .  g.11052
gacacaaaaccacagtttctctcgtcactccttctctgtaaaagcctcaggatgtaggaa  c.173+660

         .         .         .         .         .         .  g.11112
tgtccgctggtggccagtaagtcagatatggctggaaatcctaaggtgacctataccaca  c.173+720

         .         .         .         .         .         .  g.11172
cctcaaggttctcagggaattttgcagagttccatggtcctacataggtcagaacctgaa  c.173+780

         .         .         .         .         .         .  g.11232
gatgtgcagaacacagctaaagcagtggccctgccaagccttggtcatctgacatgctca  c.173+840

         .         .         .         .         .         .  g.11292
gggaatctgttgtgtccaagagaatccctttctggatagctgagatttgaccgtttaagc  c.173+900

         .         .         .         .         .         .  g.11352
accacatctgactttcagctgccttttcaaacattttgatgaaaaaaaatttcccaaaga  c.173+960

         .         .         .         .         .         .  g.11412
gattttacactcttcttctttcttttttaaaaaatataacatttagtatttttattaatt  c.173+1020

         .         .         .         .         .         .  g.11472
atcgtttattttaaaactaagaagatatggtttaaggcaaaaaaccgtatgacttgtatt  c.173+1080

         .         .         .         .         .         .  g.11532
cactactcagaagtaaccattattaagattttggtatgaatttggatttctctgtgtgtg  c.173+1140

         .         .         .         .         .         .  g.11592
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtataatcaaatcaaacttggatcatactaa  c.173+1200

         .         .         .         .         .         .  g.11652
acataatgttttattactcactttggaaactttacaaggtagcatggactctctccatgt  c.173+1260

         .         .         .         .         .         .  g.11712
cattaaatagcattttatgttggtgtttttcaaagtagtttgaggaaaattagcatcaga  c.173+1320

         .         .         .         .         .         .  g.11772
ttcacagaagggagatgctttaaaatggaggttcttgggccccacttaagccccactaaa  c.173+1380

         .         .          g.11800
tcaaactgagctctggagcctggaatct  c.173+1408

--------------------- middle of intron ---------------------
                    g.11801             .         .           g.11828
                    c.174-1408  gcatttaacaagcttacctggtgatagt  c.174-1381

.         .         .         .         .         .           g.11888
tacgccaattacatttgagaacccacatcctatgtcattacttaccatggctttgtaaca  c.174-1321

.         .         .         .         .         .           g.11948
gtccatgattgaatatgccatatccaggtcctgattgtaggatgtttaagtttttcagtt  c.174-1261

.         .         .         .         .         .           g.12008
actggatattataaacaatgccacagtgaacagacttattcagatatctgtgaccccttg  c.174-1201

.         .         .         .         .         .           g.12068
acaactgtttttgtttgtttgtttgttttgttttgttgagacagagttgtagctcttgtc  c.174-1141

.         .         .         .         .         .           g.12128
acccaggctggagttcaatggtgcgatctcaagtcactgcaacctccgcctcccgggttc  c.174-1081

.         .         .         .         .         .           g.12188
aggcaattctcctccctcagactactgagtagctgggattacaagcatgcaccactgtgc  c.174-1021

.         .         .         .         .         .           g.12248
tgcctaactttttgtgtttttagtagagacggagtttcaccatgttggccaggatgatct  c.174-961

.         .         .         .         .         .           g.12308
cgagctactgacctcaggtgatccgctcacctcggcctcccaaagtgctgggattacagg  c.174-901

.         .         .         .         .         .           g.12368
cgtgagccacagcgcccagccccttgacaactgttttttaaggaccaattgcctaaagta  c.174-841

.         .         .         .         .         .           g.12428
gaattgctggatcaagactactcttccaaaagaggacaataaacacgacctcctcttttg  c.174-781

.         .         .         .         .         .           g.12488
ttaatgacttagatcattcctctgaacagccattattgcacattgctgaaatgttcgcct  c.174-721

.         .         .         .         .         .           g.12548
ctgcactggttggtcccagaatgctaatcattttgagatttgtgccttcttccttctatt  c.174-661

.         .         .         .         .         .           g.12608
ttctgctttcctctattagccatgcccgacctgaaagccatcccttcctctttaatgtac  c.174-601

.         .         .         .         .         .           g.12668
tatttttcttctaatgtggatctacaaaaacagagtttgggcagagtctaacaacaggaa  c.174-541

.         .         .         .         .         .           g.12728
caagagaagaaacagatccaaagagaggggctttgggcacagcgatgttctggagtcagt  c.174-481

.         .         .         .         .         .           g.12788
tctcagtggtgaaggctgactgtgcatctctcttcctaacttcacttgcagccgtgtcat  c.174-421

.         .         .         .         .         .           g.12848
attgatagcttgaaatctgccacagtgggagcatttacaccatggaaattggcaaacgct  c.174-361

.         .         .         .         .         .           g.12908
acaaatcaagagtgttaattttcgttttgttttttgagagttggctattaacttaccagc  c.174-301

.         .         .         .         .         .           g.12968
atactattggctttagtgcatggcgtctatatattggtatttgttgctgggccgttattt  c.174-241

.         .         .         .         .         .           g.13028
agactgccttcttatttcttaactgtgttccaggtgggtaaaggcagcatagcactgagt  c.174-181

.         .         .         .         .         .           g.13088
tctagataactgaggggattttgcacttggatttgctgtgctaaggtttgggtggggcta  c.174-121

.         .         .         .         .         .           g.13148
ttacatcttgccgggctgggcaagagtgaaccctaggggtcaacatcagtagccaggatt  c.174-61

.         .         .         .         .         .           g.13208
ctgccataggaagcttggagtggaactgacctgccccctttctctctgtctccatggcag  c.174-1


Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center