Crystallin, beta-B2 (CRYBB2) - 1737 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5082
gtaagattgcctctcttgcttgtcttcccttctttctctcatcctcacccctgtccgcaa  c.-27+60

         .         .         .         .         .         .  g.5142
gcatgggagcacccagattctgacaagtgactttgggcagagacttcaatgctgttagcc  c.-27+120

         .         .         .         .         .         .  g.5202
tcagttttcttttctggtaactgggaagggggttaaaaagccttctttattgtaaggatt  c.-27+180

         .         .         .         .         .         .  g.5262
caagagaagttaggggatcatccagcacagtgcctggcacacagtgggcattggggcaat  c.-27+240

         .         .         .         .         .         .  g.5322
gttctttattattaatattaaacagactatcagcatccttgtttcgccagtcgctgagga  c.-27+300

         .         .         .         .         .         .  g.5382
ggagaatgtaactgagggttttgcaagaatcaaaccagtgacagttcagcattgtttcta  c.-27+360

         .         .         .         .         .         .  g.5442
ggtgggtgagtcagttttcctccacatctgcaattagggggcacccactctgtgcctagc  c.-27+420

         .         .         .         .         .         .  g.5502
ctctgggagtgctaggggataggatgcagccacaggtatgtgacaggtcccagcaacagg  c.-27+480

         .         .         .         .         .         .  g.5562
tgatttcaatgccactaaagcatggtagaaatgactctaataatgccacaattgctgcca  c.-27+540

         .         .         .         .         .         .  g.5622
tttgctgcatgctgagtgtgttctgggaccacggccaagtgcttccggttttatacatta  c.-27+600

         .         .         .         .         .         .  g.5682
cataattgaatcctcacaacctgttcacaggtattattagacatcattactgtccccatt  c.-27+660

         .         .         .         .         .         .  g.5742
ttatagaacaggaagttgaggcatagggagaggatgagacctgcccagagtctcaattct  c.-27+720

         .         .         .         .         .         .  g.5802
ggcaggcagcagagactgctcctgaactggaccaactgagcttcttcagtctgtgaacac  c.-27+780

         .         .         .         .         .         .  g.5862
tcaggactgggaagtgatatggcaggacctcaggcactctgacaagcccagagggctggt  c.-27+840

         .         .           g.5891
ttcttgcgggagagcagtagatttggctg  c.-27+869

--------------------- middle of intron ---------------------
                     g.5892             .         .           g.5919
                     c.-26-868  ccaaggtgcttaactgcatttcttcctc  c.-26-841

.         .         .         .         .         .           g.5979
ctgggaaacatccagtattggcctttcatgtggaaggggcttctggaagctggcgttatc  c.-26-781

.         .         .         .         .         .           g.6039
tctgaagagggaggccaggcttcctctcttacccctggggaaacacagcctggtttgacc  c.-26-721

.         .         .         .         .         .           g.6099
accccttctgcaggaagggggaagaggctgacaattttccaggcttttctgatgttctca  c.-26-661

.         .         .         .         .         .           g.6159
ctagctaaggcaggtctaccctgctgcctgccacagtgcctggatttctaccgtcgcacc  c.-26-601

.         .         .         .         .         .           g.6219
catttcttctctttcttgtaatgtgggttctgtatcagatgatttcactaatgggggagt  c.-26-541

.         .         .         .         .         .           g.6279
aaaaccagtggcagagaagagaaatctaggtaccaggatggggagaggagtcccagggag  c.-26-481

.         .         .         .         .         .           g.6339
agggtgggagaaggagcaggggaacagggaactttgtgagttcctaaactgggcaccacc  c.-26-421

.         .         .         .         .         .           g.6399
acaccaccaaatacagccaatgcataggttttgtttgttccacacaattttatttaagaa  c.-26-361

.         .         .         .         .         .           g.6459
attactgcataaaggcagaagttctgggattgaccattctatattctgtgtggtatccat  c.-26-301

.         .         .         .         .         .           g.6519
tgtctggggttgagtgttgggaacccactttggacctcatttaagctctagtttattact  c.-26-241

.         .         .         .         .         .           g.6579
gctctctttctttgagtagacctcgtttttccctcctcctgcagctggcctggatagaaa  c.-26-181

.         .         .         .         .         .           g.6639
taaatgaagctaaggacagaagttgaagtagctgcttacggaccccacagctctgggaca  c.-26-121

.         .         .         .         .         .           g.6699
gtctgaaaccaggagaaaaagagaatgtttggggccagaggggagtggtctcaaggcccc  c.-26-61

.         .         .         .         .         .           g.6759
acagagtgaaaaagccagtggcccctccaggtcctcactgctgcttcccatgtcttccag  c.-26-1


Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center