Sterol 27-hydroxylase (CYP27A1) - coding DNA reference sequence

(used for mutation description)

(last modified May 6, 2010)


This file was created to facilitate the description of sequence variants in the CYP27A1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007959.1, covering CYP27A1 transcript NM_000784.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5014
                                               gggagaagccgagg       c.-421

 .         .         .         .         .         .                g.5074
 gcagcttagccacggccggttcccgttccctccaggacgcgagggtcgccttgggtgggg       c.-361

 .         .         .         .         .         .                g.5134
 aaccgcgaccgggcgaggacctatcccggtgtggggcttcccgatttcgaaagaatctcg       c.-301

 .         .         .         .         .         .                g.5194
 ctgcacccccgcccagagttcagaccaagcgaaaagttatttgagaggcctcgggggcgc       c.-241

 .         .         .         .         .         .                g.5254
 ggggtgaggagtcgtggcggaggccttggtcggggcgccgtggatatccccgagtcaccg       c.-181

 .         .         .         .         .         .                g.5314
 cgtccctctcctgcagctcccgcgtcgctgggaggagcgagggagcgagcgggaaggggt       c.-121

 .         .         .         .         .         .                g.5374
 ctagctggcctttgctcggccctccccagcgcccggctttgaacccgccctgcactgctg       c.-61

 .         .         .         .         .         .                g.5434
 tctgggcgggtccggggactcagcactcgacccaaaggtgcaggcgcgcgagcacaaccc       c.-1

          .         .         .         .         .         .       g.5494
 ATGGCTGCGCTGGGCTGCGCGAGGCTGAGGTGGGCGCTGCGAGGGGCCGGCCGTGGCCTC       c.60
 M  A  A  L  G  C  A  R  L  R  W  A  L  R  G  A  G  R  G  L         p.20

          .         .         .         .         .         .       g.5554
 TGCCCCCACGGGGCCAGAGCCAAGGCCGCGATCCCTGCCGCCCTCCCCTCGGACAAGGCC       c.120
 C  P  H  G  A  R  A  K  A  A  I  P  A  A  L  P  S  D  K  A         p.40

          .         .         .         .         .         .       g.5614
 ACCGGAGCTCCCGGAGCCGGGCCTGGTGTCCGGCGGCGGCAACGGAGCTTAGAGGAGATT       c.180
 T  G  A  P  G  A  G  P  G  V  R  R  R  Q  R  S  L  E  E  I         p.60

          .         .         .         .         .         .       g.5674
 CCACGTCTAGGACAGCTGCGCTTCTTCTTTCAGCTGTTCGTTCAAGGCTATGCCCTGCAA       c.240
 P  R  L  G  Q  L  R  F  F  F  Q  L  F  V  Q  G  Y  A  L  Q         p.80

          .      | 02  .         .         .         .         .    g.32873
 CTGCACCAGTTACAG | GTGCTTTACAAGGCCAAGTACGGTCCAATGTGGATGTCCTACTTA    c.300
 L  H  Q  L  Q   | V  L  Y  K  A  K  Y  G  P  M  W  M  S  Y  L      p.100

          .         .         .         .         .         .       g.32933
 GGGCCTCAGATGCACGTGAACCTGGCCAGTGCCCCGCTCTTGGAGCAAGTGATGCGGCAA       c.360
 G  P  Q  M  H  V  N  L  A  S  A  P  L  L  E  Q  V  M  R  Q         p.120

          .         .         .         .         .         .       g.32993
 GAGGGCAAGTACCCAGTACGGAACGACATGGAGCTATGGAAGGAGCACCGGGACCAGCAC       c.420
 E  G  K  Y  P  V  R  N  D  M  E  L  W  K  E  H  R  D  Q  H         p.140

          .         .       | 03 .         .         .         .    g.35507
 GACCTGACCTATGGGCCGTTCACCAC | GGAAGGACACCACTGGTACCAGCTGCGCCAGGCT    c.480
 D  L  T  Y  G  P  F  T  T  |  E  G  H  H  W  Y  Q  L  R  Q  A      p.160

          .         .         .         .         .         .       g.35567
 CTGAACCAGCGGTTGCTGAAGCCAGCGGAAGCAGCGCTCTATACGGATGCTTTCAATGAG       c.540
 L  N  Q  R  L  L  K  P  A  E  A  A  L  Y  T  D  A  F  N  E         p.180

          .         .         .         .         .         .       g.35627
 GTGATTGATGACTTTATGACTCGACTGGACCAGCTGCGGGCAGAGAGTGCTTCGGGGAAC       c.600
 V  I  D  D  F  M  T  R  L  D  Q  L  R  A  E  S  A  S  G  N         p.200

          .         .         .         .       | 04 .         .    g.35817
 CAGGTGTCGGACATGGCTCAACTCTTCTACTACTTTGCCTTGGAAG | CTATTTGCTACATC    c.660
 Q  V  S  D  M  A  Q  L  F  Y  Y  F  A  L  E  A |   I  C  Y  I      p.220

          .         .         .         .         .         .       g.35877
 CTGTTCGAGAAACGCATTGGCTGCCTGCAGCGATCCATCCCCGAGGACACCGTGACCTTC       c.720
 L  F  E  K  R  I  G  C  L  Q  R  S  I  P  E  D  T  V  T  F         p.240

          .         .         .         .         .         .       g.35937
 GTCAGATCCATCGGGTTAATGTTCCAGAACTCACTCTATGCCACCTTCCTCCCCAAGTGG       c.780
 V  R  S  I  G  L  M  F  Q  N  S  L  Y  A  T  F  L  P  K  W         p.260

          .         .         .         .         .         .       g.35997
 ACTCGCCCCGTGCTGCCTTTCTGGAAGCGATACCTGGATGGTTGGAATGCCATCTTTTCC       c.840
 T  R  P  V  L  P  F  W  K  R  Y  L  D  G  W  N  A  I  F  S         p.280

      | 05   .         .         .         .         .         .    g.36231
 TTTG | GGAAGAAGCTGATTGATGAGAAGCTCGAAGATATGGAGGCCCAACTGCAGGCAGCA    c.900
 F  G |   K  K  L  I  D  E  K  L  E  D  M  E  A  Q  L  Q  A  A      p.300

          .         .         .         .         .         .       g.36291
 GGGCCAGATGGCATCCAGGTGTCTGGCTACCTGCACTTCTTACTGGCCAGTGGACAGCTC       c.960
 G  P  D  G  I  Q  V  S  G  Y  L  H  F  L  L  A  S  G  Q  L         p.320

          .         .         .         .         .        | 06.    g.37275
 AGTCCTCGGGAGGCCATGGGCAGCCTGCCTGAGCTGCTCATGGCTGGAGTGGACACG | ACA    c.1020
 S  P  R  E  A  M  G  S  L  P  E  L  L  M  A  G  V  D  T   | T      p.340

          .         .         .         .         .         .       g.37335
 TCCAACACGCTGACATGGGCCCTGTACCACCTCTCAAAGGACCCTGAGATCCAGGAGGCC       c.1080
 S  N  T  L  T  W  A  L  Y  H  L  S  K  D  P  E  I  Q  E  A         p.360

          .         .         .         .         .         .       g.37395
 TTGCACGAGGAAGTGGTGGGTGTGGTGCCAGCCGGGCAAGTGCCCCAGCACAAGGACTTT       c.1140
 L  H  E  E  V  V  G  V  V  P  A  G  Q  V  P  Q  H  K  D  F         p.380

          .         .         .         .     | 07   .         .    g.37647
 GCCCACATGCCGTTGCTCAAAGCTGTGCTTAAGGAGACTCTGCG | TCTCTACCCTGTGGTC    c.1200
 A  H  M  P  L  L  K  A  V  L  K  E  T  L  R  |  L  Y  P  V  V      p.400

          .         .         .         .         .         .       g.37707
 CCCACAAACTCCCGGATCATAGAAAAGGAAATTGAAGTTGATGGCTTCCTCTTCCCCAAG       c.1260
 P  T  N  S  R  I  I  E  K  E  I  E  V  D  G  F  L  F  P  K         p.420

     | 08    .         .         .         .         .         .    g.37853
 AAC | ACCCAGTTTGTGTTCTGCCACTATGTGGTGTCCCGGGACCCCACTGCCTTCTCTGAG    c.1320
 N   | T  Q  F  V  F  C  H  Y  V  V  S  R  D  P  T  A  F  S  E      p.440

          .         .         .         .         .         .       g.37913
 CCTGAAAGCTTCCAGCCCCACCGCTGGCTGAGAAACAGCCAGCCTGCTACCCCCAGGATC       c.1380
 P  E  S  F  Q  P  H  R  W  L  R  N  S  Q  P  A  T  P  R  I         p.460

          .         .         .         .         .         .       g.37973
 CAGCACCCATTTGGCTCTGTGCCCTTTGGCTATGGGGTCCGGGCCTGCCTGGGCCGCAGG       c.1440
 Q  H  P  F  G  S  V  P  F  G  Y  G  V  R  A  C  L  G  R  R         p.480

          .         .         .       | 09 .         .         .    g.38186
 ATTGCAGAGCTGGAGATGCAGCTACTCCTCGCAAGG | CTGATCCAGAAGTACAAGGTGGTC    c.1500
 I  A  E  L  E  M  Q  L  L  L  A  R   | L  I  Q  K  Y  K  V  V      p.500

          .         .         .         .         .         .       g.38246
 CTGGCCCCGGAGACGGGGGAGTTGAAGAGTGTGGCCCGCATTGTCCTGGTTCCCAATAAG       c.1560
 L  A  P  E  T  G  E  L  K  S  V  A  R  I  V  L  V  P  N  K         p.520

          .         .         .                                     g.38282
 AAAGTGGGCCTGCAGTTCCTGCAGAGACAGTGCTGA                               c.1596
 K  V  G  L  Q  F  L  Q  R  Q  C  X                                 p.531

          .         .         .         .         .         .       g.38342
 gctgagtctccgccttgctggggcttgtcctagaggctccagctctggcacagtggttcc       c.*60

          .         .         .         .         .         .       g.38402
 tggctgctgccatgtctcagatgaggagggagagaaggaggccgccagactcgagaggtg       c.*120

          .         .         .         .         .         .       g.38462
 ggaggaactccttgcacacaccctgagcttttgccacttctatcatttttgagcaactcc       c.*180

          .         .         .         .         .         .       g.38522
 ctctcagctaaaaggccacccctttatcgcattgctgtccttgggtagaatataaaataa       c.*240

          .         .                                               g.38545
 agggacttttatttcttattgga                                            c.*263

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sterol 27-hydroxylase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 26
©2004-2010 Leiden University Medical Center