porcupine homolog (Drosophila) (PORCN) - coding DNA reference sequence

(used for mutation description)

(last modified February 12, 2010)


This file was created to facilitate the description of sequence variants in the PORCN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009278.1, covering PORCN transcript NM_203473.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5038
                       cgccgctctgggagccgctgctggtcccggccttgcgg       c.-121

 .         .         .         .         .         .                g.5098
 cctgcgggggaggctgcccggaggaggcagcggcggcggcagcgcgtcctcggtccccag       c.-61

 .         .         .   | 02     .         .         .             g.5838
 gaccacggcttctttcctgccag | atctatccatctggccatccatccgtgggggtctgca    c.-1

          .         .         .         .         .         .       g.5898
 ATGGCCACCTTTAGCCGCCAGGAATTTTTCCAGCAGCTACTGCAAGGCTGTCTCCTGCCT       c.60
 M  A  T  F  S  R  Q  E  F  F  Q  Q  L  L  Q  G  C  L  L  P         p.20

          .         .         .         .         .         .       g.5958
 ACTGCCCAGCAGGGCCTTGACCAGATCTGGCTGCTCCTTGCCATCTGCCTCGCCTGCCGC       c.120
 T  A  Q  Q  G  L  D  Q  I  W  L  L  L  A  I  C  L  A  C  R         p.40

          .       | 03 .         .         .         .         .    g.7356
 CTCCTCTGGAGGCTCG | GGTTGCCATCCTACCTGAAGCATGCAAGCACCGTGGCAGGCGGG    c.180
 L  L  W  R  L  G |   L  P  S  Y  L  K  H  A  S  T  V  A  G  G      p.60

          .         .         .         .         .         .       g.7416
 TTCTTCAGCCTCTACCACTTCTTCCAGCTGCACATGGTTTGGGTCGTGCTGCTCAGCCTC       c.240
 F  F  S  L  Y  H  F  F  Q  L  H  M  V  W  V  V  L  L  S  L         p.80

          .         .         .         .         .         .       g.7476
 CTGTGCTACCTCGTGCTGTTCCTCTGCCGACATTCCTCCCATCGAGGCGTCTTCCTATCC       c.300
 L  C  Y  L  V  L  F  L  C  R  H  S  S  H  R  G  V  F  L  S         p.100

          .         .          | 04        .         .         .    g.7940
 GTCACCATCCTCATCTACCTACTCATGGG | TGAGATGCACATGGTAGACACCGTGACATGG    c.360
 V  T  I  L  I  Y  L  L  M  G  |  E  M  H  M  V  D  T  V  T  W      p.120

          .    | 05    .         .         .         .         .    g.8390
 CACAAGATGCGAG | GGGCACAGATGATTGTGGCCATGAAGGCAGTGTCTCTGGGCTTCGAC    c.420
 H  K  M  R  G |   A  Q  M  I  V  A  M  K  A  V  S  L  G  F  D      p.140

          .         .         .         .         .         .       g.8450
 CTGGACCGGGGCGAGGTGGGTACGGTGCCCTCGCCAGTGGAGTTCATGGGCTACCTCTAC       c.480
 L  D  R  G  E  V  G  T  V  P  S  P  V  E  F  M  G  Y  L  Y         p.160

          .         .         .         .         .         .       g.8510
 TTCGTGGGCACCATCGTCTTCGGGCCCTGGATATCCTTCCACAGCTACCTACAAGCTGTC       c.540
 F  V  G  T  I  V  F  G  P  W  I  S  F  H  S  Y  L  Q  A  V         p.180

          .      | 06  .         .         .         .         .    g.8651
 CAAGGCCGCCCACTG | AGCTGCCGGTGGCTGCAGAAGGTGGCCCGGAGCCTGGCACTGGCC    c.600
 Q  G  R  P  L   | S  C  R  W  L  Q  K  V  A  R  S  L  A  L  A      p.200

          .         .         .         .         .         .       g.8711
 CTGCTGTGCCTTGTGCTGTCCACTTGCGTGGGCCCCTACCTCTTCCCGTACTTCATCCCC       c.660
 L  L  C  L  V  L  S  T  C  V  G  P  Y  L  F  P  Y  F  I  P         p.220

          .         .       | 07 .         .     | 08   .         . g.10273
 CTCAACGGTGACCGCCTCCTTCGCAA | CAAGAAACGCAAAGCCAG | GTGGCTGCGAGCCTAC c.720
 L  N  G  D  R  L  L  R  N  |  K  K  R  K  A  R  |  W  L  R  A  Y   p.240

          .         .         .         .         .         .       g.10333
 GAGAGTGCTGTCTCCTTCCACTTCAGCAACTATTTTGTGGGCTTTCTTTCCGAGGCCACG       c.780
 E  S  A  V  S  F  H  F  S  N  Y  F  V  G  F  L  S  E  A  T         p.260

          .         .         .         .         . | 09       .    g.10552
 GCCACGTTGGCGGGGGCTGGCTTTACCGAGGAGAAGGATCACCTGGAATG | GGACCTGACG    c.840
 A  T  L  A  G  A  G  F  T  E  E  K  D  H  L  E  W  |  D  L  T      p.280

          .         .         .         .         .         .       g.10612
 GTGTCCAAGCCACTGAATGTGGAGCTGCCTCGGTCAATGGTGGAAGTTGTCACAAGCTGG       c.900
 V  S  K  P  L  N  V  E  L  P  R  S  M  V  E  V  V  T  S  W         p.300

          .         .         .  | 10      .         .         .    g.11763
 AACCTGCCCATGTCTTATTGGCTAAATAACT | ATGTTTTCAAGAATGCTCTCCGCCTGGGG    c.960
 N  L  P  M  S  Y  W  L  N  N  Y |   V  F  K  N  A  L  R  L  G      p.320

          .         .         .         .         | 11         .    g.11919
 ACCTTCTCGGCTGTGCTGGTCACCTATGCAGCCAGCGCCCTCCTACAT | GGCTTCAGTTTC    c.1020
 T  F  S  A  V  L  V  T  Y  A  A  S  A  L  L  H   | G  F  S  F      p.340

          .         .         .         .         .   | 12     .    g.12086
 CACCTGGCTGCGGTCCTGCTGTCCCTGGCTTTTATCACTTACGTGGAGCATG | TCCTCCGG    c.1080
 H  L  A  A  V  L  L  S  L  A  F  I  T  Y  V  E  H  V |   L  R      p.360

          .         .         .         .         .         .       g.12146
 AAGCGCCTGGCTCGGATCCTCAGTGCCTGTGTCTTGTCAAAGCGGTGCCCGCCAGACTGT       c.1140
 K  R  L  A  R  I  L  S  A  C  V  L  S  K  R  C  P  P  D  C         p.380

          .         | 13         .         .         .         .    g.13242
 TCGCACCAGCATCGCTTG | GGCCTGGGGGTGCGAGCCTTAAACTTGCTCTTTGGAGCTCTG    c.1200
 S  H  Q  H  R  L   | G  L  G  V  R  A  L  N  L  L  F  G  A  L      p.400

          .         .         .         .         .         .       g.13302
 GCCATCTTCCACCTGGCCTACCTGGGCTCCCTGTTTGATGTCGATGTGGATGACACCACA       c.1260
 A  I  F  H  L  A  Y  L  G  S  L  F  D  V  D  V  D  D  T  T         p.420

           | 14        .         .         .         .         .    g.16443
 GAGGAGCAG | GGCTACGGCATGGCATACACTGTCCACAAGTGGTCAGAGCTCAGCTGGGCC    c.1320
 E  E  Q   | G  Y  G  M  A  Y  T  V  H  K  W  S  E  L  S  W  A      p.440

          .         .         .         .         .                 g.16494
 AGTCACTGGGTCACTTTTGGATGCTGGATCTTCTACCGTCTCATAGGCTGA                c.1371
 S  H  W  V  T  F  G  C  W  I  F  Y  R  L  I  G  X                  p.456

          .         .         .         .         .         .       g.16554
 ggcacatctgtggaccctcataaccctcttaagacccctctcagggtgccactgatgggg       c.*60

          .         .         .         .         .         .       g.16614
 gatgagggaaggccctctctctactccttgaccccctccatccttgacccccaacacctc       c.*120

          .         .         .         .         .         .       g.16674
 aacacacacacacacacacacacacaaaatcacaccattttcatgcctgtcaatccccac       c.*180

          .         .         .         .         .         .       g.16734
 cccaccacaaggcaggaagggggtggtgcctgctggggcctagagggggatgcttgggga       c.*240

          .         .         .         .         .         .       g.16794
 aacagagaaggggagatccagggcctccccgccttccttcttcctttttatatacaattt       c.*300

          .         .         .                                     g.16832
 gttattgtcaaataaaagtaggaaatattcaataggct                             c.*338

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Porcupine homolog (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 24
©2004-2010 Leiden University Medical Center