von Willebrand factor (VWF) - 582 nt intron 51 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.179945
gtaagggctctgcttcaataagggctgggtgtggagggctgagcctccgtgttcggatac  c.8253+60

         .         .         .         .         .         .  g.180005
ctatccttagttacattctagaaggatctggaaaattcgcagggaagagaagggaaataa  c.8253+120

         .         .         .         .         .         .  g.180065
actggaagcatttttttttaagcaaatgttttattgaagtaactggaaatttttgactcc  c.8253+180

         .         .         .         .         .         .  g.180125
aggaaaaaaacaaaaatggaggaaagactcagcaaatcctttacagaaaatggagagtta  c.8253+240

         .         .         .         .         .   g.180176
tttatgcaagatgggggccacaattcttgaagatcagtcaaacatatataa  c.8253+291

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.180227
         aattttcctgcataaaacatgcataatcaggcataaaacattttatgcatt  c.8254-241

.         .         .         .         .         .           g.180287
aacatgcataaaaattgcagctagaggggtgtgggtatgatattattaccatagagaaga  c.8254-181

.         .         .         .         .         .           g.180347
ggacatgtcagacctatgatcttcctttacaaattgcctagctgtcctgggtgcttctgg  c.8254-121

.         .         .         .         .         .           g.180407
gtgagatcagacctgccttgcttggagggggtcagggagaaagcaggctgccccagagcc  c.8254-61

.         .         .         .         .         .           g.180467
ctgcctaagccaggacttcccaccattgtgaagctcccatcttcctctgctttcttgcag  c.8254-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center