von Willebrand factor (VWF) - 1960 nt intron 50 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.177887
gtgagtgcgttactaatatcttgtcccttgaaacccatcagagcaagtccaggggctctt  c.8155+60

         .         .         .         .         .         .  g.177947
tgcagcttgctccttgaaacccattagcaagccgcatgactgttctttggagtaagcttt  c.8155+120

         .         .         .         .         .         .  g.178007
atttcagaaagatatttcgtgaccactggtcagtcattatgttcagtcttgcagggagca  c.8155+180

         .         .         .         .         .         .  g.178067
gcctcccctccttggatgtcatcagactgccctcttgaactcccttttagatcccatgga  c.8155+240

         .         .         .         .         .         .  g.178127
gcaatctctttccccttttcctgcaaactccctcctgtctccagcttcttatgtgccttt  c.8155+300

         .         .         .         .         .         .  g.178187
tccctcataggatctttgattgctcatagtcctatcctgggacgatatgttccctctcta  c.8155+360

         .         .         .         .         .         .  g.178247
accaaagcttcttgaagacaggcaccttggatctatgatcctgacagagtagactctcaa  c.8155+420

         .         .         .         .         .         .  g.178307
cacatatctattcatgagtgtgctaaagctatctcaaagagaaagcgaagccaccagctg  c.8155+480

         .         .         .         .         .         .  g.178367
gctgacaacagcccacatgtgctgtgggggctggtctaagtttatcaccccctcttcttc  c.8155+540

         .         .         .         .         .         .  g.178427
actctgagctcctctttacctcgtagttatgtcctactgattggttctcattgctcacag  c.8155+600

         .         .         .         .         .         .  g.178487
cagcagctttggagacgagacacaaatctgcacatcagacagtgttcttcccatacatgc  c.8155+660

         .         .         .         .         .         .  g.178547
ttgtgtttgtgagcacaaataactttcaggatcccaatgctaatgccataatttctgaat  c.8155+720

         .         .         .         .         .         .  g.178607
atagaattacttgcctggactaagattttttgttttagattagggtatttcttttctgcc  c.8155+780

         .         .         .         .         .         .  g.178667
ctgggttcacaggtccatgcttgtttacagatagagaaaggaagagtgaaaacatgaata  c.8155+840

         .         .         .         .         .         .  g.178727
ctttcagtgttcaatcattcattcttgacagcccctgcaattgctgtaaccaaatctcag  c.8155+900

         .         .         .         .         .         .  g.178787
atcgaggaagcactctgaaagcatgtctttctatgattcccatttgaatggtttaagaat  c.8155+960

         .         .  g.178807
gtgaagtcaggaaaccatca  c.8155+980

--------------------- middle of intron ---------------------
                            g.178808    .         .           g.178827
                            c.8156-980  gagaagaagaattctctcta  c.8156-961

.         .         .         .         .         .           g.178887
ggcacactgcacgtggaatttgattaggagactgttacctacaaaaccaccacaaagggt  c.8156-901

.         .         .         .         .         .           g.178947
ctttgttggtcaactcattcaagaggcttcgagatctttaataaggacaataagccaggc  c.8156-841

.         .         .         .         .         .           g.179007
tcagggccttaaatccacagcaacatagtatagtatgctggtctaaatgttttttttttt  c.8156-781

.         .         .         .         .         .           g.179067
taattcatcctcttaatgtaattggcaggctttccctttacaatgaaattatctagaaat  c.8156-721

.         .         .         .         .         .           g.179127
taggaggcagactaatatgtagttagggttgatttagatttcgagccatctaaggacaga  c.8156-661

.         .         .         .         .         .           g.179187
aaactcccagtgttcagactggaatggtgagctgggattaaatttttgaattcccagtgg  c.8156-601

.         .         .         .         .         .           g.179247
gccaagtagagattcagatctgaatgccactaacccctgtgtgaaaggaaacccccatgt  c.8156-541

.         .         .         .         .         .           g.179307
cagcaacctggagtcagcagtacccgaagagaggccttcacaaaggtgcctagggatctt  c.8156-481

.         .         .         .         .         .           g.179367
ctcggtccccagagaggcagggtatgcccttacatcaccatgacttcgcctttcctctta  c.8156-421

.         .         .         .         .         .           g.179427
ccccaaggcaggaatgaagagatagtaattatacttattgactacttcattgcccattag  c.8156-361

.         .         .         .         .         .           g.179487
cttctgaatgtagttacaagcacaagagggttgctttagccatgtggtttttagagtcta  c.8156-301

.         .         .         .         .         .           g.179547
caatgatacaaaggcaagtcttcctcattttacatcaccatagcacagtgaatttaggct  c.8156-241

.         .         .         .         .         .           g.179607
cttcctgcaattaaaattgtaccattaagtgagttaagtccagcaataactatatctctg  c.8156-181

.         .         .         .         .         .           g.179667
catatttcgggccaggaacagctgaggtgaaccaggataactgaattccctccctgtggc  c.8156-121

.         .         .         .         .         .           g.179727
tggctttatttggttactgtgaaagggacctatttccagcccagtgagggcactggggct  c.8156-61

.         .         .         .         .         .           g.179787
gaagagtgttctctagaaccccagccagtcctcaagtttcatctctcacctgtcctgtag  c.8156-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center