von Willebrand factor (VWF) - 507 nt intron 49 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.177340
gtgagtactcattctgctttcctctttactgtctcaatctctaagaacaagattcttctg  c.8115+60

         .         .         .         .         .         .  g.177400
aatagtgtgcatcccagctccggcataatttctcagtgtctgaggcacatctctggccta  c.8115+120

         .         .         .         .         .         .  g.177460
gttgaagaatcagtgagattacgaaatcaaagcctacggagagataaaattctctgcaat  c.8115+180

         .         .         .         .         .         .  g.177520
ataggatgttttaaaaaaatattttccttaagggaggctgagtgtgtgattcttgaataa  c.8115+240

         .      g.177534
aatgtgagatcaaa  c.8115+254

--------------------- middle of intron ---------------------
                                   g.177535       .           g.177547
                                   c.8116-253  ctgatttttagtc  c.8116-241

.         .         .         .         .         .           g.177607
tccctgggaatgaagatcctgatgactcaactggaagagaattcagaatcatcaaaattg  c.8116-181

.         .         .         .         .         .           g.177667
tttcagcctggtcaggtagggtggtcaagctgctcacatttatgataggaaagcatagtt  c.8116-121

.         .         .         .         .         .           g.177727
tacatctgggcacttaagcacagggctgtgagttcggagctaaaaattggcccggagtga  c.8116-61

.         .         .         .         .         .           g.177787
cctgaaagctgtctactctgtactgtttgtgcctaacctgaaattttgctgttttcttag  c.8116-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center